ID: 1137547119

View in Genome Browser
Species Human (GRCh38)
Location 16:49411860-49411882
Sequence TCTTGGATTCGGGTTGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137547119_1137547130 9 Left 1137547119 16:49411860-49411882 CCCAAACCAACCCGAATCCAAGA No data
Right 1137547130 16:49411892-49411914 CCCTGGCCCCCAAGCTCAGGAGG No data
1137547119_1137547124 -8 Left 1137547119 16:49411860-49411882 CCCAAACCAACCCGAATCCAAGA No data
Right 1137547124 16:49411875-49411897 ATCCAAGATAAAATTCCCCCTGG No data
1137547119_1137547132 10 Left 1137547119 16:49411860-49411882 CCCAAACCAACCCGAATCCAAGA No data
Right 1137547132 16:49411893-49411915 CCTGGCCCCCAAGCTCAGGAGGG No data
1137547119_1137547126 6 Left 1137547119 16:49411860-49411882 CCCAAACCAACCCGAATCCAAGA No data
Right 1137547126 16:49411889-49411911 TCCCCCTGGCCCCCAAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137547119 Original CRISPR TCTTGGATTCGGGTTGGTTT GGG (reversed) Intergenic
No off target data available for this crispr