ID: 1137547122

View in Genome Browser
Species Human (GRCh38)
Location 16:49411870-49411892
Sequence GGGAATTTTATCTTGGATTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137547122_1137547130 -1 Left 1137547122 16:49411870-49411892 CCCGAATCCAAGATAAAATTCCC No data
Right 1137547130 16:49411892-49411914 CCCTGGCCCCCAAGCTCAGGAGG No data
1137547122_1137547132 0 Left 1137547122 16:49411870-49411892 CCCGAATCCAAGATAAAATTCCC No data
Right 1137547132 16:49411893-49411915 CCTGGCCCCCAAGCTCAGGAGGG No data
1137547122_1137547126 -4 Left 1137547122 16:49411870-49411892 CCCGAATCCAAGATAAAATTCCC No data
Right 1137547126 16:49411889-49411911 TCCCCCTGGCCCCCAAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137547122 Original CRISPR GGGAATTTTATCTTGGATTC GGG (reversed) Intergenic
No off target data available for this crispr