ID: 1137547123

View in Genome Browser
Species Human (GRCh38)
Location 16:49411871-49411893
Sequence GGGGAATTTTATCTTGGATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137547123_1137547130 -2 Left 1137547123 16:49411871-49411893 CCGAATCCAAGATAAAATTCCCC No data
Right 1137547130 16:49411892-49411914 CCCTGGCCCCCAAGCTCAGGAGG No data
1137547123_1137547132 -1 Left 1137547123 16:49411871-49411893 CCGAATCCAAGATAAAATTCCCC No data
Right 1137547132 16:49411893-49411915 CCTGGCCCCCAAGCTCAGGAGGG No data
1137547123_1137547126 -5 Left 1137547123 16:49411871-49411893 CCGAATCCAAGATAAAATTCCCC No data
Right 1137547126 16:49411889-49411911 TCCCCCTGGCCCCCAAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137547123 Original CRISPR GGGGAATTTTATCTTGGATT CGG (reversed) Intergenic
No off target data available for this crispr