ID: 1137547124

View in Genome Browser
Species Human (GRCh38)
Location 16:49411875-49411897
Sequence ATCCAAGATAAAATTCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137547119_1137547124 -8 Left 1137547119 16:49411860-49411882 CCCAAACCAACCCGAATCCAAGA No data
Right 1137547124 16:49411875-49411897 ATCCAAGATAAAATTCCCCCTGG No data
1137547113_1137547124 22 Left 1137547113 16:49411830-49411852 CCCGCACTGAACACCAGCCTGCT No data
Right 1137547124 16:49411875-49411897 ATCCAAGATAAAATTCCCCCTGG No data
1137547120_1137547124 -9 Left 1137547120 16:49411861-49411883 CCAAACCAACCCGAATCCAAGAT No data
Right 1137547124 16:49411875-49411897 ATCCAAGATAAAATTCCCCCTGG No data
1137547117_1137547124 -6 Left 1137547117 16:49411858-49411880 CCCCCAAACCAACCCGAATCCAA No data
Right 1137547124 16:49411875-49411897 ATCCAAGATAAAATTCCCCCTGG No data
1137547114_1137547124 21 Left 1137547114 16:49411831-49411853 CCGCACTGAACACCAGCCTGCTA No data
Right 1137547124 16:49411875-49411897 ATCCAAGATAAAATTCCCCCTGG No data
1137547112_1137547124 23 Left 1137547112 16:49411829-49411851 CCCCGCACTGAACACCAGCCTGC No data
Right 1137547124 16:49411875-49411897 ATCCAAGATAAAATTCCCCCTGG No data
1137547116_1137547124 5 Left 1137547116 16:49411847-49411869 CCTGCTAGCATCCCCCAAACCAA No data
Right 1137547124 16:49411875-49411897 ATCCAAGATAAAATTCCCCCTGG No data
1137547115_1137547124 9 Left 1137547115 16:49411843-49411865 CCAGCCTGCTAGCATCCCCCAAA No data
Right 1137547124 16:49411875-49411897 ATCCAAGATAAAATTCCCCCTGG No data
1137547118_1137547124 -7 Left 1137547118 16:49411859-49411881 CCCCAAACCAACCCGAATCCAAG No data
Right 1137547124 16:49411875-49411897 ATCCAAGATAAAATTCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137547124 Original CRISPR ATCCAAGATAAAATTCCCCC TGG Intergenic
No off target data available for this crispr