ID: 1137547132

View in Genome Browser
Species Human (GRCh38)
Location 16:49411893-49411915
Sequence CCTGGCCCCCAAGCTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137547117_1137547132 12 Left 1137547117 16:49411858-49411880 CCCCCAAACCAACCCGAATCCAA No data
Right 1137547132 16:49411893-49411915 CCTGGCCCCCAAGCTCAGGAGGG No data
1137547121_1137547132 4 Left 1137547121 16:49411866-49411888 CCAACCCGAATCCAAGATAAAAT No data
Right 1137547132 16:49411893-49411915 CCTGGCCCCCAAGCTCAGGAGGG No data
1137547125_1137547132 -7 Left 1137547125 16:49411877-49411899 CCAAGATAAAATTCCCCCTGGCC No data
Right 1137547132 16:49411893-49411915 CCTGGCCCCCAAGCTCAGGAGGG No data
1137547115_1137547132 27 Left 1137547115 16:49411843-49411865 CCAGCCTGCTAGCATCCCCCAAA No data
Right 1137547132 16:49411893-49411915 CCTGGCCCCCAAGCTCAGGAGGG No data
1137547116_1137547132 23 Left 1137547116 16:49411847-49411869 CCTGCTAGCATCCCCCAAACCAA No data
Right 1137547132 16:49411893-49411915 CCTGGCCCCCAAGCTCAGGAGGG No data
1137547118_1137547132 11 Left 1137547118 16:49411859-49411881 CCCCAAACCAACCCGAATCCAAG No data
Right 1137547132 16:49411893-49411915 CCTGGCCCCCAAGCTCAGGAGGG No data
1137547122_1137547132 0 Left 1137547122 16:49411870-49411892 CCCGAATCCAAGATAAAATTCCC No data
Right 1137547132 16:49411893-49411915 CCTGGCCCCCAAGCTCAGGAGGG No data
1137547123_1137547132 -1 Left 1137547123 16:49411871-49411893 CCGAATCCAAGATAAAATTCCCC No data
Right 1137547132 16:49411893-49411915 CCTGGCCCCCAAGCTCAGGAGGG No data
1137547119_1137547132 10 Left 1137547119 16:49411860-49411882 CCCAAACCAACCCGAATCCAAGA No data
Right 1137547132 16:49411893-49411915 CCTGGCCCCCAAGCTCAGGAGGG No data
1137547120_1137547132 9 Left 1137547120 16:49411861-49411883 CCAAACCAACCCGAATCCAAGAT No data
Right 1137547132 16:49411893-49411915 CCTGGCCCCCAAGCTCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137547132 Original CRISPR CCTGGCCCCCAAGCTCAGGA GGG Intergenic
No off target data available for this crispr