ID: 1137547263

View in Genome Browser
Species Human (GRCh38)
Location 16:49413022-49413044
Sequence TTCCAGGTACAGTCCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137547259_1137547263 -2 Left 1137547259 16:49413001-49413023 CCTCCTCTACATTCCTAAGAATT No data
Right 1137547263 16:49413022-49413044 TTCCAGGTACAGTCCCTGCCTGG No data
1137547260_1137547263 -5 Left 1137547260 16:49413004-49413026 CCTCTACATTCCTAAGAATTCCA No data
Right 1137547263 16:49413022-49413044 TTCCAGGTACAGTCCCTGCCTGG No data
1137547258_1137547263 8 Left 1137547258 16:49412991-49413013 CCTGCTCTGACCTCCTCTACATT No data
Right 1137547263 16:49413022-49413044 TTCCAGGTACAGTCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137547263 Original CRISPR TTCCAGGTACAGTCCCTGCC TGG Intergenic
No off target data available for this crispr