ID: 1137548375

View in Genome Browser
Species Human (GRCh38)
Location 16:49419438-49419460
Sequence TTCTTGGAGGAAGAGTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137548375_1137548378 -3 Left 1137548375 16:49419438-49419460 CCTGCTCACTCTTCCTCCAAGAA No data
Right 1137548378 16:49419458-49419480 GAAGCACCATAGACATTGTCTGG No data
1137548375_1137548380 4 Left 1137548375 16:49419438-49419460 CCTGCTCACTCTTCCTCCAAGAA No data
Right 1137548380 16:49419465-49419487 CATAGACATTGTCTGGAGTGAGG No data
1137548375_1137548383 15 Left 1137548375 16:49419438-49419460 CCTGCTCACTCTTCCTCCAAGAA No data
Right 1137548383 16:49419476-49419498 TCTGGAGTGAGGCTCAGGGCTGG No data
1137548375_1137548381 10 Left 1137548375 16:49419438-49419460 CCTGCTCACTCTTCCTCCAAGAA No data
Right 1137548381 16:49419471-49419493 CATTGTCTGGAGTGAGGCTCAGG No data
1137548375_1137548382 11 Left 1137548375 16:49419438-49419460 CCTGCTCACTCTTCCTCCAAGAA No data
Right 1137548382 16:49419472-49419494 ATTGTCTGGAGTGAGGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137548375 Original CRISPR TTCTTGGAGGAAGAGTGAGC AGG (reversed) Intergenic
No off target data available for this crispr