ID: 1137548377

View in Genome Browser
Species Human (GRCh38)
Location 16:49419454-49419476
Sequence ACAATGTCTATGGTGCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137548377_1137548383 -1 Left 1137548377 16:49419454-49419476 CCAAGAAGCACCATAGACATTGT No data
Right 1137548383 16:49419476-49419498 TCTGGAGTGAGGCTCAGGGCTGG No data
1137548377_1137548381 -6 Left 1137548377 16:49419454-49419476 CCAAGAAGCACCATAGACATTGT No data
Right 1137548381 16:49419471-49419493 CATTGTCTGGAGTGAGGCTCAGG No data
1137548377_1137548382 -5 Left 1137548377 16:49419454-49419476 CCAAGAAGCACCATAGACATTGT No data
Right 1137548382 16:49419472-49419494 ATTGTCTGGAGTGAGGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137548377 Original CRISPR ACAATGTCTATGGTGCTTCT TGG (reversed) Intergenic
No off target data available for this crispr