ID: 1137548380

View in Genome Browser
Species Human (GRCh38)
Location 16:49419465-49419487
Sequence CATAGACATTGTCTGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137548376_1137548380 -9 Left 1137548376 16:49419451-49419473 CCTCCAAGAAGCACCATAGACAT No data
Right 1137548380 16:49419465-49419487 CATAGACATTGTCTGGAGTGAGG No data
1137548375_1137548380 4 Left 1137548375 16:49419438-49419460 CCTGCTCACTCTTCCTCCAAGAA No data
Right 1137548380 16:49419465-49419487 CATAGACATTGTCTGGAGTGAGG No data
1137548373_1137548380 28 Left 1137548373 16:49419414-49419436 CCGGGCCAGGGTGAGTGTGGGCA No data
Right 1137548380 16:49419465-49419487 CATAGACATTGTCTGGAGTGAGG No data
1137548374_1137548380 23 Left 1137548374 16:49419419-49419441 CCAGGGTGAGTGTGGGCAGCCTG No data
Right 1137548380 16:49419465-49419487 CATAGACATTGTCTGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137548380 Original CRISPR CATAGACATTGTCTGGAGTG AGG Intergenic