ID: 1137548383

View in Genome Browser
Species Human (GRCh38)
Location 16:49419476-49419498
Sequence TCTGGAGTGAGGCTCAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137548377_1137548383 -1 Left 1137548377 16:49419454-49419476 CCAAGAAGCACCATAGACATTGT No data
Right 1137548383 16:49419476-49419498 TCTGGAGTGAGGCTCAGGGCTGG No data
1137548376_1137548383 2 Left 1137548376 16:49419451-49419473 CCTCCAAGAAGCACCATAGACAT No data
Right 1137548383 16:49419476-49419498 TCTGGAGTGAGGCTCAGGGCTGG No data
1137548375_1137548383 15 Left 1137548375 16:49419438-49419460 CCTGCTCACTCTTCCTCCAAGAA No data
Right 1137548383 16:49419476-49419498 TCTGGAGTGAGGCTCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137548383 Original CRISPR TCTGGAGTGAGGCTCAGGGC TGG Intergenic
No off target data available for this crispr