ID: 1137550016

View in Genome Browser
Species Human (GRCh38)
Location 16:49431138-49431160
Sequence ATCAGGATTCGGGATGTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137550016_1137550023 22 Left 1137550016 16:49431138-49431160 CCCTCGACATCCCGAATCCTGAT No data
Right 1137550023 16:49431183-49431205 TTACCAGCACCCTCCCATGGCGG No data
1137550016_1137550022 19 Left 1137550016 16:49431138-49431160 CCCTCGACATCCCGAATCCTGAT No data
Right 1137550022 16:49431180-49431202 CATTTACCAGCACCCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137550016 Original CRISPR ATCAGGATTCGGGATGTCGA GGG (reversed) Intergenic
No off target data available for this crispr