ID: 1137550019

View in Genome Browser
Species Human (GRCh38)
Location 16:49431149-49431171
Sequence AGAGTGGTGACATCAGGATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137550019_1137550023 11 Left 1137550019 16:49431149-49431171 CCGAATCCTGATGTCACCACTCT No data
Right 1137550023 16:49431183-49431205 TTACCAGCACCCTCCCATGGCGG No data
1137550019_1137550022 8 Left 1137550019 16:49431149-49431171 CCGAATCCTGATGTCACCACTCT No data
Right 1137550022 16:49431180-49431202 CATTTACCAGCACCCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137550019 Original CRISPR AGAGTGGTGACATCAGGATT CGG (reversed) Intergenic
No off target data available for this crispr