ID: 1137550020

View in Genome Browser
Species Human (GRCh38)
Location 16:49431155-49431177
Sequence TTGTTTAGAGTGGTGACATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137550020_1137550029 27 Left 1137550020 16:49431155-49431177 CCTGATGTCACCACTCTAAACAA No data
Right 1137550029 16:49431205-49431227 GCACCGTGACTGCCCGCACAAGG No data
1137550020_1137550022 2 Left 1137550020 16:49431155-49431177 CCTGATGTCACCACTCTAAACAA No data
Right 1137550022 16:49431180-49431202 CATTTACCAGCACCCTCCCATGG No data
1137550020_1137550030 28 Left 1137550020 16:49431155-49431177 CCTGATGTCACCACTCTAAACAA No data
Right 1137550030 16:49431206-49431228 CACCGTGACTGCCCGCACAAGGG No data
1137550020_1137550023 5 Left 1137550020 16:49431155-49431177 CCTGATGTCACCACTCTAAACAA No data
Right 1137550023 16:49431183-49431205 TTACCAGCACCCTCCCATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137550020 Original CRISPR TTGTTTAGAGTGGTGACATC AGG (reversed) Intergenic
No off target data available for this crispr