ID: 1137550021

View in Genome Browser
Species Human (GRCh38)
Location 16:49431165-49431187
Sequence GGTAAATGTTTTGTTTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137550021_1137550023 -5 Left 1137550021 16:49431165-49431187 CCACTCTAAACAAAACATTTACC No data
Right 1137550023 16:49431183-49431205 TTACCAGCACCCTCCCATGGCGG No data
1137550021_1137550030 18 Left 1137550021 16:49431165-49431187 CCACTCTAAACAAAACATTTACC No data
Right 1137550030 16:49431206-49431228 CACCGTGACTGCCCGCACAAGGG No data
1137550021_1137550029 17 Left 1137550021 16:49431165-49431187 CCACTCTAAACAAAACATTTACC No data
Right 1137550029 16:49431205-49431227 GCACCGTGACTGCCCGCACAAGG No data
1137550021_1137550022 -8 Left 1137550021 16:49431165-49431187 CCACTCTAAACAAAACATTTACC No data
Right 1137550022 16:49431180-49431202 CATTTACCAGCACCCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137550021 Original CRISPR GGTAAATGTTTTGTTTAGAG TGG (reversed) Intergenic