ID: 1137550022

View in Genome Browser
Species Human (GRCh38)
Location 16:49431180-49431202
Sequence CATTTACCAGCACCCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137550017_1137550022 18 Left 1137550017 16:49431139-49431161 CCTCGACATCCCGAATCCTGATG No data
Right 1137550022 16:49431180-49431202 CATTTACCAGCACCCTCCCATGG No data
1137550019_1137550022 8 Left 1137550019 16:49431149-49431171 CCGAATCCTGATGTCACCACTCT No data
Right 1137550022 16:49431180-49431202 CATTTACCAGCACCCTCCCATGG No data
1137550018_1137550022 9 Left 1137550018 16:49431148-49431170 CCCGAATCCTGATGTCACCACTC No data
Right 1137550022 16:49431180-49431202 CATTTACCAGCACCCTCCCATGG No data
1137550016_1137550022 19 Left 1137550016 16:49431138-49431160 CCCTCGACATCCCGAATCCTGAT No data
Right 1137550022 16:49431180-49431202 CATTTACCAGCACCCTCCCATGG No data
1137550021_1137550022 -8 Left 1137550021 16:49431165-49431187 CCACTCTAAACAAAACATTTACC No data
Right 1137550022 16:49431180-49431202 CATTTACCAGCACCCTCCCATGG No data
1137550020_1137550022 2 Left 1137550020 16:49431155-49431177 CCTGATGTCACCACTCTAAACAA No data
Right 1137550022 16:49431180-49431202 CATTTACCAGCACCCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137550022 Original CRISPR CATTTACCAGCACCCTCCCA TGG Intergenic
No off target data available for this crispr