ID: 1137550029

View in Genome Browser
Species Human (GRCh38)
Location 16:49431205-49431227
Sequence GCACCGTGACTGCCCGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137550024_1137550029 -4 Left 1137550024 16:49431186-49431208 CCAGCACCCTCCCATGGCGGCAC No data
Right 1137550029 16:49431205-49431227 GCACCGTGACTGCCCGCACAAGG No data
1137550025_1137550029 -10 Left 1137550025 16:49431192-49431214 CCCTCCCATGGCGGCACCGTGAC No data
Right 1137550029 16:49431205-49431227 GCACCGTGACTGCCCGCACAAGG No data
1137550020_1137550029 27 Left 1137550020 16:49431155-49431177 CCTGATGTCACCACTCTAAACAA No data
Right 1137550029 16:49431205-49431227 GCACCGTGACTGCCCGCACAAGG No data
1137550021_1137550029 17 Left 1137550021 16:49431165-49431187 CCACTCTAAACAAAACATTTACC No data
Right 1137550029 16:49431205-49431227 GCACCGTGACTGCCCGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137550029 Original CRISPR GCACCGTGACTGCCCGCACA AGG Intergenic
No off target data available for this crispr