ID: 1137550030

View in Genome Browser
Species Human (GRCh38)
Location 16:49431206-49431228
Sequence CACCGTGACTGCCCGCACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137550021_1137550030 18 Left 1137550021 16:49431165-49431187 CCACTCTAAACAAAACATTTACC No data
Right 1137550030 16:49431206-49431228 CACCGTGACTGCCCGCACAAGGG No data
1137550024_1137550030 -3 Left 1137550024 16:49431186-49431208 CCAGCACCCTCCCATGGCGGCAC No data
Right 1137550030 16:49431206-49431228 CACCGTGACTGCCCGCACAAGGG No data
1137550020_1137550030 28 Left 1137550020 16:49431155-49431177 CCTGATGTCACCACTCTAAACAA No data
Right 1137550030 16:49431206-49431228 CACCGTGACTGCCCGCACAAGGG No data
1137550026_1137550030 -10 Left 1137550026 16:49431193-49431215 CCTCCCATGGCGGCACCGTGACT No data
Right 1137550030 16:49431206-49431228 CACCGTGACTGCCCGCACAAGGG No data
1137550025_1137550030 -9 Left 1137550025 16:49431192-49431214 CCCTCCCATGGCGGCACCGTGAC No data
Right 1137550030 16:49431206-49431228 CACCGTGACTGCCCGCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137550030 Original CRISPR CACCGTGACTGCCCGCACAA GGG Intergenic
No off target data available for this crispr