ID: 1137550097

View in Genome Browser
Species Human (GRCh38)
Location 16:49431650-49431672
Sequence CGGGTTGCAATGAAAGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137550092_1137550097 13 Left 1137550092 16:49431614-49431636 CCATATTATTTTTCTGAAAATTC No data
Right 1137550097 16:49431650-49431672 CGGGTTGCAATGAAAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137550097 Original CRISPR CGGGTTGCAATGAAAGGAAC TGG Intergenic
No off target data available for this crispr