ID: 1137552352

View in Genome Browser
Species Human (GRCh38)
Location 16:49447107-49447129
Sequence CTGTAGTACTGGAGTAAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137552352_1137552355 -6 Left 1137552352 16:49447107-49447129 CCGTCTTTACTCCAGTACTACAG No data
Right 1137552355 16:49447124-49447146 CTACAGGCTCTTGATTACTATGG No data
1137552352_1137552357 28 Left 1137552352 16:49447107-49447129 CCGTCTTTACTCCAGTACTACAG No data
Right 1137552357 16:49447158-49447180 GTCTCAAAATCAGATAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137552352 Original CRISPR CTGTAGTACTGGAGTAAAGA CGG (reversed) Intergenic
No off target data available for this crispr