ID: 1137553657

View in Genome Browser
Species Human (GRCh38)
Location 16:49456718-49456740
Sequence CCTGGGGCCAAGAAGCCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137553650_1137553657 17 Left 1137553650 16:49456678-49456700 CCATCTGCACTGTCTACTTGCCA No data
Right 1137553657 16:49456718-49456740 CCTGGGGCCAAGAAGCCTCAAGG No data
1137553649_1137553657 21 Left 1137553649 16:49456674-49456696 CCATCCATCTGCACTGTCTACTT No data
Right 1137553657 16:49456718-49456740 CCTGGGGCCAAGAAGCCTCAAGG No data
1137553651_1137553657 -3 Left 1137553651 16:49456698-49456720 CCATGCTGTGACACAACTGCCCT No data
Right 1137553657 16:49456718-49456740 CCTGGGGCCAAGAAGCCTCAAGG No data
1137553648_1137553657 22 Left 1137553648 16:49456673-49456695 CCCATCCATCTGCACTGTCTACT No data
Right 1137553657 16:49456718-49456740 CCTGGGGCCAAGAAGCCTCAAGG No data
1137553647_1137553657 23 Left 1137553647 16:49456672-49456694 CCCCATCCATCTGCACTGTCTAC No data
Right 1137553657 16:49456718-49456740 CCTGGGGCCAAGAAGCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137553657 Original CRISPR CCTGGGGCCAAGAAGCCTCA AGG Intergenic
No off target data available for this crispr