ID: 1137553951

View in Genome Browser
Species Human (GRCh38)
Location 16:49458534-49458556
Sequence TGCCATCCTTGGGCAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137553951_1137553955 -6 Left 1137553951 16:49458534-49458556 CCACCTGCTGCCCAAGGATGGCA No data
Right 1137553955 16:49458551-49458573 ATGGCAAGTAAGAGAGTGTGTGG No data
1137553951_1137553956 4 Left 1137553951 16:49458534-49458556 CCACCTGCTGCCCAAGGATGGCA No data
Right 1137553956 16:49458561-49458583 AGAGAGTGTGTGGCTCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137553951 Original CRISPR TGCCATCCTTGGGCAGCAGG TGG (reversed) Intergenic
No off target data available for this crispr