ID: 1137556678

View in Genome Browser
Species Human (GRCh38)
Location 16:49474681-49474703
Sequence CACTCACCTCCTGCTCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137556678_1137556690 28 Left 1137556678 16:49474681-49474703 CCAGTAAGAGCAGGAGGTGAGTG No data
Right 1137556690 16:49474732-49474754 TTTCTGGGCACTCATTCCCCTGG No data
1137556678_1137556687 13 Left 1137556678 16:49474681-49474703 CCAGTAAGAGCAGGAGGTGAGTG No data
Right 1137556687 16:49474717-49474739 AGGACCAGCCAGGGCTTTCTGGG No data
1137556678_1137556681 3 Left 1137556678 16:49474681-49474703 CCAGTAAGAGCAGGAGGTGAGTG No data
Right 1137556681 16:49474707-49474729 GCTCAGCCCCAGGACCAGCCAGG No data
1137556678_1137556682 4 Left 1137556678 16:49474681-49474703 CCAGTAAGAGCAGGAGGTGAGTG No data
Right 1137556682 16:49474708-49474730 CTCAGCCCCAGGACCAGCCAGGG No data
1137556678_1137556691 29 Left 1137556678 16:49474681-49474703 CCAGTAAGAGCAGGAGGTGAGTG No data
Right 1137556691 16:49474733-49474755 TTCTGGGCACTCATTCCCCTGGG No data
1137556678_1137556680 -7 Left 1137556678 16:49474681-49474703 CCAGTAAGAGCAGGAGGTGAGTG No data
Right 1137556680 16:49474697-49474719 GTGAGTGGCAGCTCAGCCCCAGG No data
1137556678_1137556686 12 Left 1137556678 16:49474681-49474703 CCAGTAAGAGCAGGAGGTGAGTG No data
Right 1137556686 16:49474716-49474738 CAGGACCAGCCAGGGCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137556678 Original CRISPR CACTCACCTCCTGCTCTTAC TGG (reversed) Intergenic
No off target data available for this crispr