ID: 1137556975

View in Genome Browser
Species Human (GRCh38)
Location 16:49477040-49477062
Sequence AAGAAGAAGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9570
Summary {0: 36, 1: 155, 2: 521, 3: 2021, 4: 6837}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137556968_1137556975 12 Left 1137556968 16:49477005-49477027 CCTTGGACAGTAAATATTTTTAA No data
Right 1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG 0: 36
1: 155
2: 521
3: 2021
4: 6837
1137556967_1137556975 13 Left 1137556967 16:49477004-49477026 CCCTTGGACAGTAAATATTTTTA No data
Right 1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG 0: 36
1: 155
2: 521
3: 2021
4: 6837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137556975 Original CRISPR AAGAAGAAGGAGGAGGAGGA GGG Intergenic
Too many off-targets to display for this crispr