ID: 1137558732

View in Genome Browser
Species Human (GRCh38)
Location 16:49489616-49489638
Sequence GGGAGTCTTCTAGAAGATGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137558728_1137558732 -5 Left 1137558728 16:49489598-49489620 CCAGAAGCCCCTTGATATGGGAG 0: 1
1: 0
2: 1
3: 8
4: 100
Right 1137558732 16:49489616-49489638 GGGAGTCTTCTAGAAGATGATGG 0: 1
1: 0
2: 2
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137558732 Original CRISPR GGGAGTCTTCTAGAAGATGA TGG Exonic
901731269 1:11281657-11281679 GGAAGTGTTCTGGATGATGACGG - Intronic
901865613 1:12104855-12104877 GGGAGTTTCCTAGAAGATTGGGG + Intronic
902198560 1:14816472-14816494 GGGAAGCTTCTAGAATCTGAGGG - Intronic
905014022 1:34764827-34764849 GGGATTTTTCAAGAAGGTGAAGG - Intronic
906202927 1:43971524-43971546 GGGAGGCGTCTAGAAGAGTATGG + Exonic
906726416 1:48047713-48047735 GGGTGTCCACTAGGAGATGAGGG + Intergenic
909152957 1:72031863-72031885 GGGAATATTCAAGAAGAGGAAGG + Intronic
911887744 1:103326066-103326088 GGTAGTCTTAGAGAAGATCAAGG + Intergenic
913003151 1:114601935-114601957 TGGAGTGTTCTAGAAGAGAAGGG - Intronic
913087690 1:115454242-115454264 GGAAGTCTTCTAGAAGGAGGGGG - Intergenic
913551440 1:119920589-119920611 GGGAGTTGTCTAGATGATGCAGG - Intronic
913616084 1:120560309-120560331 GGGAGGCTTCAGGAAGGTGAAGG - Intergenic
915981325 1:160421733-160421755 GGGAGTCTGGTAGAAGTGGAGGG + Intronic
918335237 1:183504047-183504069 GGGAGTGTTGGAAAAGATGAGGG - Intronic
1064285828 10:13990481-13990503 GGGAGTGTGCTAGGAAATGAGGG + Intronic
1066757801 10:38728423-38728445 GGAAGTGTTCTGGAAGAAGAAGG + Intergenic
1072516473 10:96188229-96188251 TGGACTCTTCTGCAAGATGAGGG + Intronic
1073763485 10:106656241-106656263 GGAAGTCTTAAAAAAGATGAAGG + Intronic
1073790088 10:106931146-106931168 GAGAGTCTTCTAGGAGAAGAAGG - Intronic
1074054082 10:109906476-109906498 GGGTGTCTTGTGGAACATGAGGG - Intronic
1076338175 10:129724418-129724440 GGGAATGTTCTAGACCATGACGG + Intronic
1076441038 10:130481548-130481570 GGGCGGCTTCCAGCAGATGAGGG - Intergenic
1079314154 11:19393341-19393363 GGGAGGCTTCTAAAATATGCTGG + Intronic
1079455950 11:20636448-20636470 GGGAGTCTTCAAGAGGAGCATGG - Intronic
1079725217 11:23872131-23872153 GAAAGTCTTCTTGAAGATGAGGG - Intergenic
1083331742 11:61901667-61901689 GGGTGTCCTCTAGAAGCTGAGGG + Intronic
1084740721 11:71137822-71137844 GGGTGTCTTCTAGGAGTTGATGG - Intronic
1085855339 11:80169744-80169766 GGTAGTCTCCTGGAAGAAGATGG - Intergenic
1085909860 11:80810095-80810117 GGGAGATTGCTAGATGATGATGG + Intergenic
1088604049 11:111512316-111512338 GGGAGACGCCTAGAAGATGGAGG - Exonic
1091413950 12:263891-263913 GGAAGTCTTCTTGAAGGAGACGG + Intergenic
1091991996 12:4962951-4962973 CAGAGCCTTCTAGAAGGTGATGG + Intergenic
1095636692 12:44442576-44442598 GAGAGCCTACTAGAAGATTATGG + Intergenic
1102642505 12:114379394-114379416 GGGAGTCTTCTAGCAGAGGAAGG - Intronic
1108499537 13:51057123-51057145 AGGAGTCTGATAGGAGATGAAGG - Intergenic
1109217175 13:59603185-59603207 GGGAAGCTGCTGGAAGATGATGG + Intergenic
1110667640 13:78136515-78136537 GAGAGTCTTCCATAAGAAGAGGG + Intergenic
1113281164 13:108789410-108789432 GGGAGTCCTCTGAAAAATGAAGG - Intronic
1114557636 14:23571091-23571113 GGAAGTCTTCGAGAGGAGGAGGG - Exonic
1114728095 14:24960592-24960614 GGGAGTGTTCTGGAAGAGAAAGG - Intronic
1114913140 14:27225955-27225977 GAGAGTATGATAGAAGATGATGG + Intergenic
1118156456 14:63247082-63247104 GGGAGGCTTCTAGGAGAGAAAGG + Intronic
1124247781 15:28085421-28085443 GAGACTCTTCTAGAAGATTAGGG - Intronic
1127702431 15:61514306-61514328 GAGAGTCTTCTTGAGGAAGAGGG + Intergenic
1130128065 15:81110900-81110922 AGGGGTCTGCTAGAAGCTGAAGG + Intronic
1134806904 16:17133769-17133791 AAGAGTGTTCTAGAAGATGAGGG - Intronic
1136720016 16:32312407-32312429 GGAAGTATTCTGGAAGAAGAAGG - Intergenic
1136725069 16:32350801-32350823 GGAAGTATTCTGGAAGAAGAAGG - Intergenic
1136838393 16:33518686-33518708 GGAAGTATTCTGGAAGAAGAAGG - Intergenic
1136843396 16:33556854-33556876 GGAAGTATTCTGGAAGAAGAAGG - Intergenic
1137558732 16:49489616-49489638 GGGAGTCTTCTAGAAGATGATGG + Exonic
1139090898 16:63645907-63645929 GGAAGACTTTTAGAACATGAAGG + Intergenic
1139450545 16:67025421-67025443 GGGACCCTTCTAGAACATGGTGG + Intergenic
1142030140 16:87834517-87834539 GGGTGTCTTCCAGAAGGAGACGG + Exonic
1142183269 16:88681912-88681934 TGGAGTCATCTAGAACAAGAAGG + Intronic
1203001361 16_KI270728v1_random:166953-166975 GGAAGTATTCTGGAAGAAGAAGG + Intergenic
1203006415 16_KI270728v1_random:205362-205384 GGAAGTATTCTGGAAGAAGAAGG + Intergenic
1203132964 16_KI270728v1_random:1703357-1703379 GGAAGTATTCTGGAAGAAGAAGG + Intergenic
1203148557 16_KI270728v1_random:1818971-1818993 GGAAGTATTCTGGAAGAAGAAGG - Intergenic
1203153561 16_KI270728v1_random:1857152-1857174 GGAAGTATTCTGGAAGAAGAAGG - Intergenic
1145771781 17:27498549-27498571 GGGAAGCTTATAGAAGATGGAGG + Intronic
1146168925 17:30617522-30617544 GGGAGTCGTTCAGAAGTTGAGGG + Intergenic
1146170637 17:30629927-30629949 GGGAGTCGTTCAGAAGTTGAGGG - Intergenic
1146344089 17:32045948-32045970 GGGAGTCATTCAGAAGTTGAGGG - Intronic
1148457903 17:47820831-47820853 GGGAGTTTTCTGCAAGATCATGG - Intronic
1150875011 17:68961320-68961342 GGGATTCTTCTAGACATTGACGG + Intergenic
1150966265 17:69972686-69972708 GACAGTATTTTAGAAGATGAAGG - Intergenic
1151315618 17:73320275-73320297 GAGACTCTTCTAGAAGAAAATGG + Intergenic
1153540701 18:6151052-6151074 GGGAGTCTACTAGAAGAAAACGG + Intronic
1155523730 18:26695567-26695589 GTTAGCCTTCTAGAGGATGAGGG - Intergenic
1156976767 18:43231521-43231543 TGGAGTCTTCAAGAAAATAATGG + Intergenic
1157180053 18:45489006-45489028 CACAGTCTTCTAGAAGATGCAGG - Intronic
1158485864 18:57865210-57865232 GTGAGTCTGCTAGAAGAGCAAGG + Intergenic
1159662643 18:71117784-71117806 GGGTGTGTTCTGGAATATGAGGG + Intergenic
1163319907 19:16568495-16568517 GGGAGCCTTATAGAGGATCAGGG - Intronic
1163676094 19:18656033-18656055 GGGGGTGTTCTAGATGAGGAAGG - Intronic
1164435355 19:28224004-28224026 GTGAGTTTGCTAGAAAATGAGGG + Intergenic
1164809179 19:31142579-31142601 GGGATTTTTTTAGAAGAAGATGG + Intergenic
926365567 2:12129960-12129982 GGGAGTCTCCCAGAAGAGGCAGG - Intergenic
927170689 2:20367067-20367089 GGGACTGTACTAGAAGCTGAAGG + Intergenic
928431224 2:31219921-31219943 TGGACTCTTCTAGAAGAAGTGGG - Intronic
928439691 2:31281976-31281998 AGGAGTCCTCTAGAAGGTGAGGG + Intergenic
933105117 2:78315323-78315345 AGGAGGCTTCTATAAGATCAAGG - Intergenic
933722756 2:85408947-85408969 GGAAGCCTTCAAGAAGAGGATGG - Intronic
934321111 2:91972864-91972886 GGAAGTGTTCTGGAAGAAGAAGG + Intergenic
939136799 2:138306018-138306040 GGGACTCTTCTGGAAGACAAGGG - Intergenic
942523574 2:176829731-176829753 GGAAGTCTTCTAGAAGAAATTGG + Intergenic
942686713 2:178540283-178540305 TGGAGTGTTCCAGAAGATGAAGG - Exonic
943503850 2:188728394-188728416 AGGACTGTTCTAGAAGACGAAGG + Intergenic
947017284 2:225635116-225635138 GGGAGTCTTCTTGGATATGGAGG - Intronic
948014638 2:234678073-234678095 TGGAGTCTTCTGGAAGATTTGGG + Intergenic
948302561 2:236918976-236918998 TGAACTCTTCTAGAAGATGGTGG + Intergenic
948311082 2:236987407-236987429 GGAATTCTTCTGGAAGATAAGGG + Intergenic
949026467 2:241768565-241768587 GGCAGCCCTCTAGAAGATGTGGG - Exonic
1169302064 20:4451681-4451703 GCTAGTCTACTGGAAGATGAAGG + Intergenic
1169788239 20:9383680-9383702 GGGATTTTTCTTGGAGATGATGG - Intronic
1173231342 20:41201247-41201269 CGGAGTATTGTAGAAGCTGAAGG - Intronic
1175746728 20:61462249-61462271 TGGAGTTCTCTTGAAGATGAAGG + Intronic
1177126973 21:17206417-17206439 GGGAGGATTGTAGAAGATGGAGG - Intergenic
1177267417 21:18802475-18802497 GGCAGTCTCCTAGAATAAGAAGG + Intergenic
1179149900 21:38800909-38800931 GAGAATCTTCCAGAAGATGAGGG + Intergenic
1179540340 21:42079544-42079566 GTGAGCCTTCTAGAACCTGAGGG - Intronic
1179571287 21:42280303-42280325 TGGAATGTTCTAGAAGATCATGG + Intronic
1180309353 22:11156836-11156858 GGAAGTATTCTGGAAGAAGAAGG + Intergenic
1180547830 22:16518647-16518669 GGAAGTATTCTGGAAGAAGAAGG + Intergenic
1181983439 22:26782576-26782598 GGGAGTCTTGGAGAGTATGAAGG + Intergenic
1182984842 22:34706588-34706610 GGGAGTCTTCTGGGAGAGGCTGG + Intergenic
1184050880 22:42003653-42003675 AGGAGTCTTCAAAAAGATCATGG + Intronic
1184343417 22:43898580-43898602 GGAAGGCTTCTTGGAGATGATGG + Intergenic
949812036 3:8016457-8016479 GGGTATCTGCTAGAAGAGGAAGG - Intergenic
950043609 3:9935326-9935348 GGGAGAGTGCTAGAAGGTGAAGG + Intronic
950880193 3:16317037-16317059 TGGAGTCTCCGAGGAGATGAAGG - Exonic
951825041 3:26859386-26859408 GAGAGCCTTCCTGAAGATGAAGG - Intergenic
951875990 3:27426340-27426362 GGGACTCTTCTGGAAGTTTAGGG - Intronic
955044403 3:55346438-55346460 GTGAGACTTCTAAAAGATGAGGG + Intergenic
958550102 3:95601324-95601346 GAGAGTTATCTAGAAAATGAAGG + Intergenic
959399910 3:105887083-105887105 GGGAGTCAAATAGAAGAAGACGG - Intergenic
959530605 3:107431065-107431087 GGGTGTCTTCGAGAGGATAACGG + Intergenic
963061189 3:141228510-141228532 GGGAGTCCTCTAGGGGATGGAGG - Intergenic
963111318 3:141690567-141690589 GGAAGTGATTTAGAAGATGAGGG - Intergenic
963564636 3:146913150-146913172 GGGAGACTCTTAGAAGATGTGGG + Intergenic
966666587 3:182478452-182478474 GGAAGGCTTTTAGAAGATGTGGG + Intergenic
968577659 4:1375495-1375517 GGGAGTCACCTGGCAGATGAGGG - Exonic
969093005 4:4710178-4710200 TAGGGTCTTCTAGAAGCTGACGG + Intergenic
969204494 4:5633169-5633191 GGGAAACTTCTAGGAGCTGAGGG + Intronic
971898113 4:32622805-32622827 TTGAGTCTTTTAGAAGTTGAAGG + Intergenic
974047682 4:56910658-56910680 GGCAGTCTTCTGGAGGAGGAGGG + Exonic
978197548 4:105988905-105988927 GGGAGACTTCAAGGAGTTGAGGG - Intronic
981878829 4:149582423-149582445 GGGTGACTTCTAGAAGACCAAGG + Intergenic
982507613 4:156239961-156239983 GGGTGCCTTCTAGGAGCTGAGGG - Intergenic
984701720 4:182822671-182822693 CGCAGTTTTCTAGAAGCTGATGG - Intergenic
987667412 5:20961840-20961862 GTGAGTTTTCTACCAGATGAAGG - Intergenic
987790366 5:22558441-22558463 AGGAGTCTTCTAGAAGAAAATGG - Intronic
990306054 5:54494880-54494902 GGGTGGCTTCTAGGAGCTGATGG - Intergenic
997370018 5:133353560-133353582 GGGAATGTTGTAGAAAATGAGGG + Intronic
997441467 5:133911583-133911605 GGGACACTTCTAGGGGATGAAGG + Intergenic
1000686443 5:164255413-164255435 GGAAGTCTTCTGGATGCTGAGGG - Intergenic
1001380880 5:171305689-171305711 GAGAGTCATCTAGAAGAGGGTGG - Intergenic
1003320887 6:5049976-5049998 GTCATTCTTCTAGAATATGAAGG + Intergenic
1004156199 6:13170537-13170559 GGGAGTCTAGTAGCTGATGAAGG + Intronic
1004842455 6:19602869-19602891 ATGAGTCTTCTAGAAGACCAAGG + Intergenic
1005903232 6:30237653-30237675 GGGAGTATCCTAGAAGATTTTGG - Intergenic
1006550854 6:34822001-34822023 GGTAGGCTTTTAGAAGATAAGGG + Intronic
1006596970 6:35200714-35200736 GGGACTCTTCTGGAAGGTTAAGG - Intergenic
1006971857 6:38053721-38053743 AGGAATCTTATAGATGATGATGG + Intronic
1009204124 6:60781278-60781300 GAGAGTTTTCTTGAAGAAGACGG + Intergenic
1011242884 6:85290635-85290657 GGCAATCTTATAGAAGAAGATGG + Intergenic
1013308631 6:108872897-108872919 GAGACTCTCCAAGAAGATGAGGG - Intronic
1017576718 6:155813638-155813660 GGGTGTTTTCTACCAGATGAGGG - Intergenic
1019958864 7:4440180-4440202 GGGCCTATTCTAGAAGATAAAGG - Intergenic
1020943107 7:14564845-14564867 TAGAGTCTACTAGAAGAAGATGG - Intronic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1026103742 7:67404136-67404158 GGGAGTTCACTAGAAGATGGAGG + Intergenic
1027816733 7:82982519-82982541 GAGACTATTCTAGGAGATGAGGG - Intronic
1029545272 7:101207282-101207304 GGGTGTCTTCAGGGAGATGACGG + Intronic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1030921423 7:115393522-115393544 AAGACTCTTCTAGAAAATGAAGG - Intergenic
1031398579 7:121303737-121303759 GGGAGGCTGCTAGAAGTTCAGGG + Intergenic
1032546143 7:132744694-132744716 GGGAGTTTTTTAAAAGAAGAGGG + Intergenic
1033516004 7:142106923-142106945 AGGAGTCTTTTATAAGATGTGGG + Intergenic
1037808187 8:22069899-22069921 GGGAGGCTTCTTGTAGATGTTGG - Exonic
1039113571 8:34067192-34067214 GGCAGTTTTCCAGAAGAGGAAGG + Intergenic
1039829774 8:41203862-41203884 GGGAGTCTTCCTAAAGAGGAAGG - Intergenic
1044250410 8:89999228-89999250 AGGTGACTTCTAGAAGCTGAAGG + Intronic
1045040493 8:98219318-98219340 GGGATTCTTTTAGAAGACGTTGG + Intronic
1045287134 8:100801582-100801604 GGGTGGCTTCTAGGAGCTGAAGG + Intergenic
1045916660 8:107480185-107480207 GGGAGTCTTCAAAAAGCTCATGG + Intronic
1047726219 8:127686239-127686261 AGGAGTCCTTTGGAAGATGAAGG + Intergenic
1047844226 8:128788603-128788625 GGGTGTCTTATAGGAGATGTTGG + Intergenic
1049862721 8:144911073-144911095 GGGACTCCTCCAGAAGAGGAGGG - Intergenic
1050209309 9:3235273-3235295 GGGAGTGTTCCAGATGATGACGG + Intronic
1050781754 9:9345303-9345325 GAGAGACTTGCAGAAGATGAGGG - Intronic
1051778876 9:20666704-20666726 GGGTGTTTTCTAGAAAATTATGG + Intronic
1053002051 9:34582474-34582496 TGGGGTCTTATAGAAGGTGAGGG - Intronic
1053353860 9:37430596-37430618 GGACTTCTTCCAGAAGATGAAGG + Exonic
1056452524 9:86729787-86729809 GGGATTCTTCCAGAATGTGATGG + Intergenic
1056721721 9:89077839-89077861 GGGAGCCTTCAAGAAGAGAAAGG - Exonic
1058555545 9:106162994-106163016 TGGAGTTTTCTAAAAAATGAAGG + Intergenic
1058771983 9:108243932-108243954 GAGAGTCTACTAGAAGTAGAGGG + Intergenic
1060257727 9:122047308-122047330 GGGAGTTGACTAGGAGATGAGGG + Intronic
1061594681 9:131621234-131621256 GAGTGTTTTCTAGAAGAGGAAGG + Intronic
1061852003 9:133421870-133421892 GTGAGTCTTCCAGGAGATGAAGG + Intronic
1062288701 9:135785145-135785167 GGGAGTCTTCAGGAAGAATACGG + Intronic
1187087937 X:16061240-16061262 GGGAGGCCTCTAGAAACTGAAGG - Intergenic
1187916253 X:24154962-24154984 GGGGGTCTACTAGAGGGTGAAGG + Intronic
1195598717 X:106722264-106722286 GGGAGTGTTCAAGCAGATGCTGG + Intronic
1195620611 X:106950808-106950830 GGGTGTGGTCTAGAAGATGGGGG - Intronic
1195754368 X:108186786-108186808 GGGAGAGTTCAAGAAGAAGATGG - Intronic
1195994844 X:110721522-110721544 AGGAGTCTTCTAGAACAGGGTGG + Exonic
1198114044 X:133527656-133527678 GGAAGTCTTCGTGAGGATGATGG + Intergenic
1199002386 X:142654328-142654350 GGAAGTCTTCTAGAAAGAGATGG - Intergenic
1200985306 Y:9297079-9297101 GGGATTCTTATAGAAGATGATGG + Intergenic
1201188598 Y:11427986-11428008 GGAAGTGTTCTGGAAGAAGAAGG + Intergenic