ID: 1137559596

View in Genome Browser
Species Human (GRCh38)
Location 16:49494173-49494195
Sequence GAATGCCTATGCCATTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137559590_1137559596 11 Left 1137559590 16:49494139-49494161 CCCACACCTGGGACCACTGGTGA 0: 1
1: 1
2: 2
3: 12
4: 217
Right 1137559596 16:49494173-49494195 GAATGCCTATGCCATTCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 93
1137559594_1137559596 -2 Left 1137559594 16:49494152-49494174 CCACTGGTGAGGAAAACTCCAGA 0: 1
1: 0
2: 5
3: 16
4: 167
Right 1137559596 16:49494173-49494195 GAATGCCTATGCCATTCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 93
1137559591_1137559596 10 Left 1137559591 16:49494140-49494162 CCACACCTGGGACCACTGGTGAG 0: 1
1: 0
2: 0
3: 36
4: 239
Right 1137559596 16:49494173-49494195 GAATGCCTATGCCATTCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 93
1137559593_1137559596 5 Left 1137559593 16:49494145-49494167 CCTGGGACCACTGGTGAGGAAAA 0: 1
1: 0
2: 2
3: 21
4: 256
Right 1137559596 16:49494173-49494195 GAATGCCTATGCCATTCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137559596 Original CRISPR GAATGCCTATGCCATTCCCC AGG Intronic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
903371401 1:22838394-22838416 TAATGCCTATACTATTCCCTGGG - Intronic
908556795 1:65264562-65264584 GAATGTCTGTGCCATGCACCAGG - Intronic
909096049 1:71290669-71290691 GAAGGCCTATGACATGCCCTGGG - Intergenic
910222955 1:84907388-84907410 TAATGCCTATACCAGTCACCTGG - Intergenic
911401274 1:97378477-97378499 TAATGCCTATGCCTTTCTGCTGG + Intronic
914846565 1:151286897-151286919 GCATGCCTGGGCCATTCTCCTGG - Exonic
917606831 1:176640089-176640111 CAGTTCCTATGCCATCCCCCAGG + Intronic
920945715 1:210526541-210526563 CAATGCCTTTTCCATTCCACAGG - Intronic
924587944 1:245376437-245376459 TAATGCCTAAGCCACACCCCAGG + Intronic
924788081 1:247219034-247219056 GACTCCCTCTGACATTCCCCTGG + Intergenic
1069685172 10:70313250-70313272 GAAGGCCTATGCCTTCCCACAGG + Intronic
1071401031 10:85270941-85270963 GAATGCCAAGGCCATTCTCATGG + Intergenic
1074137093 10:110637258-110637280 GAATGACAGTGACATTCCCCAGG + Intergenic
1074910715 10:117905968-117905990 GATTGCCTGAGCCATCCCCCCGG - Intergenic
1075512244 10:123082009-123082031 GCATGCAGATGCCCTTCCCCGGG + Intergenic
1076326044 10:129623942-129623964 GATTGCCTGTGCCCTTCCCAAGG + Intronic
1076361572 10:129893118-129893140 GAAAGCCCATGCCATTTCCCGGG - Intronic
1076449980 10:130550601-130550623 AATTTCCTCTGCCATTCCCCCGG - Intergenic
1079549411 11:21675171-21675193 TAGAGCCTATGCCATTGCCCTGG + Intergenic
1083041612 11:59692948-59692970 GAATGTCTATTTTATTCCCCAGG - Intergenic
1087905115 11:103686693-103686715 GATTCTCTATGCCATTCCACTGG - Intergenic
1088428123 11:109727771-109727793 GAATACCTCTGCCATTGCCTTGG + Intergenic
1089268257 11:117282355-117282377 GAAAGCCTATGCTATACCCACGG - Intronic
1089583359 11:119495284-119495306 GAAGACATATGACATTCCCCAGG + Intergenic
1091177850 11:133577830-133577852 GAATGCCTGTGCCACTCCTGAGG + Intergenic
1092985009 12:13836905-13836927 GAATGCATTCTCCATTCCCCGGG - Intronic
1094663195 12:32491864-32491886 GCATGCCTTTGCCTTTTCCCTGG + Intronic
1096000172 12:48122807-48122829 CAATGGCTTTGCCAATCCCCAGG - Exonic
1100445438 12:94655824-94655846 GAAAGCCTATGCCCTTCCAGTGG + Intergenic
1103995995 12:124830587-124830609 GATTGGTTTTGCCATTCCCCGGG - Intronic
1114054935 14:18959737-18959759 AAATGCCTATGCCAGTCCTTTGG + Intergenic
1114107606 14:19442040-19442062 AAATGCCTATGCCAGTCCTTTGG - Intergenic
1119960227 14:78847567-78847589 AAATGCCTTTGCCTTTCCCTAGG - Intronic
1127050116 15:55073675-55073697 GAATGTGTATGGCATTACCCTGG - Intergenic
1128212542 15:65912648-65912670 GGTTTCCTATGCCATTCCTCTGG - Intronic
1129697567 15:77749332-77749354 CAAGCCCAATGCCATTCCCCAGG + Intronic
1137559596 16:49494173-49494195 GAATGCCTATGCCATTCCCCAGG + Intronic
1138218115 16:55223369-55223391 GAATGCCTTTGGCATTTCCATGG + Intergenic
1139590043 16:67928432-67928454 GGATGTCCATTCCATTCCCCAGG + Exonic
1155572533 18:27211317-27211339 GAATCTCTATCCCATTCCACAGG - Intergenic
1156053132 18:32963221-32963243 GAATGTCTATTCCATATCCCAGG + Intronic
1157174772 18:45441418-45441440 GAATGCCATAGCCATTACCCAGG + Intronic
1160321209 18:77897547-77897569 GAGGGCTTCTGCCATTCCCCTGG + Intergenic
1165396558 19:35567394-35567416 GGATGCCTGTGCCAGTCCCAAGG + Intergenic
1166274605 19:41744128-41744150 CAATGCCTGTGCCTTTTCCCAGG - Intronic
1167608855 19:50496618-50496640 AAATGCCTGTCCCCTTCCCCAGG + Intergenic
925891949 2:8441353-8441375 GAATCCCCCTGCGATTCCCCAGG - Intergenic
928680762 2:33700101-33700123 GAATGCCCAGGCCATTCTCAGGG + Intergenic
930162922 2:48176586-48176608 GAATGCCTATGGCTTTTTCCAGG + Intergenic
932683564 2:73848620-73848642 GAAGGCCTTTGCCAGGCCCCTGG - Intronic
934038496 2:88108476-88108498 CAAAGCCTATGCCATTCTCCTGG + Exonic
936450996 2:112634102-112634124 GGGTAACTATGCCATTCCCCAGG + Intergenic
939405216 2:141746700-141746722 GATGGCCTATCCCATGCCCCTGG - Intronic
945680793 2:212911576-212911598 GCATGCCTATTCTATTTCCCTGG - Intergenic
947360851 2:229343839-229343861 GTATGGCCATGCCATTCCTCAGG - Intergenic
1172286076 20:33741284-33741306 CAATGCCTGTGCCTTTGCCCTGG + Intronic
1172908645 20:38388916-38388938 GGATGCCTCTACCTTTCCCCTGG - Intergenic
1179114245 21:38475540-38475562 CCTTGCCTTTGCCATTCCCCTGG + Intronic
1180473417 22:15682287-15682309 AAATGCCTATGCCAGTCCTTTGG + Intergenic
1183706352 22:39477086-39477108 GACTCCCTCTGCCATACCCCAGG + Intronic
951583683 3:24193023-24193045 CAATTCCTATGCCATTCCCAAGG + Intronic
963518172 3:146334455-146334477 GACTCCCTCTGACATTCCCCCGG + Intergenic
964272284 3:154970182-154970204 GGAAGCCTACGACATTCCCCTGG - Intergenic
964444803 3:156747753-156747775 AAAGGCATATCCCATTCCCCTGG - Intergenic
968606987 4:1540214-1540236 GGCTGCCTCTGCCATGCCCCGGG - Intergenic
971479548 4:27102140-27102162 GAATCCCTAAGCCACTCCCCAGG + Intergenic
971587238 4:28419847-28419869 GAATTTCTATGACATTTCCCAGG - Intergenic
975667833 4:76751001-76751023 CCATGCCTATGCTTTTCCCCAGG - Intronic
981113827 4:140966793-140966815 AAATGTATATGCCATTGCCCTGG + Intronic
983484008 4:168312195-168312217 GGATGACTAGGCCATTCCCTGGG + Intronic
986697726 5:10373598-10373620 GACTGTCTTTGCCATACCCCAGG + Intronic
987452997 5:18109372-18109394 GGAAGCCTATGCCCTTCCCTGGG + Intergenic
997366677 5:133329924-133329946 GAATGCCTTTGCCAAACCCGGGG - Intronic
997719037 5:136063512-136063534 GACTGCCTATGCCAAGTCCCTGG + Exonic
1007301487 6:40871163-40871185 GAATGCTGATGCCATCCCCAAGG + Intergenic
1009530758 6:64811340-64811362 GAATGCCTATGCTTATCCCTGGG + Intronic
1013877341 6:114848923-114848945 GATTGCTTATGCCATTCCCTAGG - Intergenic
1014408625 6:121085512-121085534 GAATGCCAATGCCAATGCCAAGG - Intronic
1021492937 7:21239680-21239702 TTTTGCCTATGCCTTTCCCCAGG + Intergenic
1027965363 7:84998902-84998924 AAATTCCTATACCATTCTCCAGG + Exonic
1029325805 7:99807838-99807860 GATTCCCTCTGACATTCCCCCGG - Intergenic
1030760208 7:113341353-113341375 GATGGCCTATTCCTTTCCCCAGG - Intergenic
1036118893 8:5992944-5992966 GGATGCCAATCCCATTCACCAGG + Intergenic
1037202546 8:16275781-16275803 GAGTCTCTTTGCCATTCCCCTGG - Intronic
1039335875 8:36588714-36588736 GGATGCCTATGACATTAACCAGG + Intergenic
1044060990 8:87635371-87635393 GAATGTCTTTGGGATTCCCCAGG + Intergenic
1045564531 8:103299342-103299364 GACTGCCTTCGCCCTTCCCCCGG + Intronic
1048833859 8:138499975-138499997 GAAAGCCTCTGCCACTGCCCAGG + Intergenic
1054949233 9:70831886-70831908 GAATGACTACCCCATTCTCCAGG + Intronic
1185500978 X:597437-597459 GGATGCCTATGACAGTGCCCAGG - Intergenic
1185550578 X:980506-980528 GAAGGGCTATGCCTTCCCCCTGG + Intergenic
1186629529 X:11334241-11334263 TCTTGCCTATGCCATTCACCAGG - Intronic
1189061414 X:37757289-37757311 GAATGCCCAATCCATACCCCAGG + Intronic
1189703438 X:43735625-43735647 AAAGGCCTCTGCCATTCCCTTGG + Intronic
1193505711 X:82340976-82340998 GCATCACTATGCCATTCCTCTGG - Intergenic
1194610659 X:96039170-96039192 GAATGCCCATGACATTCACTTGG - Intergenic
1195448088 X:104976598-104976620 GAATGCCAATGCCAAAACCCTGG + Intronic
1195732788 X:107982493-107982515 GAAGGCCTCTGCCATTCCACTGG + Intergenic
1196724670 X:118885510-118885532 GACTCCCTCTGACATTCCCCCGG + Intergenic
1201434670 Y:13943975-13943997 CAATGCCTATGTCATTCACCTGG - Intergenic