ID: 1137559627

View in Genome Browser
Species Human (GRCh38)
Location 16:49494370-49494392
Sequence CTTGATGCCCCAAGGGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137559623_1137559627 9 Left 1137559623 16:49494338-49494360 CCAGGATGTCACAGCAGATGGAA 0: 1
1: 0
2: 0
3: 16
4: 242
Right 1137559627 16:49494370-49494392 CTTGATGCCCCAAGGGGACCAGG 0: 1
1: 0
2: 0
3: 12
4: 98
1137559622_1137559627 10 Left 1137559622 16:49494337-49494359 CCCAGGATGTCACAGCAGATGGA 0: 1
1: 0
2: 0
3: 20
4: 228
Right 1137559627 16:49494370-49494392 CTTGATGCCCCAAGGGGACCAGG 0: 1
1: 0
2: 0
3: 12
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137559627 Original CRISPR CTTGATGCCCCAAGGGGACC AGG Intronic
900476512 1:2878781-2878803 CTTCAGCCCCCAAGGGGACAGGG + Intergenic
901667162 1:10832734-10832756 CATGATGCTCCAAGCAGACCAGG - Intergenic
902512194 1:16972527-16972549 CTTGAGGCCCCCAAGGGACCGGG - Exonic
902720778 1:18302716-18302738 CTTGATGCCCCAGAGGCCCCTGG + Intronic
902749271 1:18495820-18495842 CTTGATGCCACAAGGACACAGGG + Intergenic
903177816 1:21591053-21591075 ATTGACGCCCCAAGGGGAAGCGG + Intergenic
904042548 1:27592983-27593005 CTGGGTGACCCAAGGTGACCAGG + Intronic
905014966 1:34771605-34771627 CTTGGGGCCCCAGGGGTACCTGG - Intronic
905246019 1:36614521-36614543 CTTGATGGCACAGGGGGTCCTGG + Intergenic
910221865 1:84895967-84895989 ATTGAAGCCCCAAGGTGAGCTGG - Intergenic
912452930 1:109778397-109778419 GTTGATGCCCCCTGGGGATCTGG - Intergenic
915490324 1:156246946-156246968 CTGAATGCCCCAAGGAGAACAGG - Intronic
1067777067 10:49171529-49171551 CCTGATGCCCCATTTGGACCTGG + Intronic
1073431126 10:103487927-103487949 CTGGACACCCCATGGGGACCAGG - Intergenic
1075453508 10:122569667-122569689 CTGGACTCCCCAAGGGGACATGG + Intronic
1076091438 10:127689701-127689723 CTAGATGCGGCAAGGGGATCTGG - Intergenic
1076680546 10:132169253-132169275 CATGGTGCTCCACGGGGACCTGG + Intronic
1076778035 10:132709112-132709134 CTGGAAGCCCCAAGGTGACCAGG - Intronic
1076904403 10:133354999-133355021 CTTGGTGTCCCCAGGGCACCAGG + Intergenic
1078511516 11:11987908-11987930 CTTCCTGCCACAAGGGGTCCAGG + Intronic
1078669239 11:13350256-13350278 CTGCATGGCCCAAGGGGGCCAGG + Intronic
1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG + Exonic
1082848620 11:57745734-57745756 CTTATTGCCCCAAGAGGACAAGG + Exonic
1088005344 11:104933045-104933067 CTTCATGCCCCAAAAGGCCCTGG - Intergenic
1090189680 11:124759868-124759890 CTGGACGCCCCCTGGGGACCCGG + Intronic
1090633283 11:128669453-128669475 CCTGGTGTCCCACGGGGACCTGG - Intergenic
1092732029 12:11544076-11544098 CAGGATGCACCAAGGGCACCTGG + Intergenic
1095532307 12:43202866-43202888 CTTCATGCCCAAAGTGCACCAGG + Intergenic
1096845678 12:54405184-54405206 CTTGACCCCCCTGGGGGACCTGG - Exonic
1097787788 12:63780070-63780092 CCTGAGGCCCCGCGGGGACCCGG - Exonic
1117257235 14:53990488-53990510 CATGAAGCCCAAAGGGGAACAGG - Intergenic
1119168013 14:72512119-72512141 CTTGGAGACCCAAGGGGAACAGG - Intronic
1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG + Intergenic
1122156306 14:99752531-99752553 CTTCCTGCACCCAGGGGACCAGG - Intronic
1126665017 15:51068330-51068352 CCAGATGCCCCATGGGTACCTGG - Intronic
1128531292 15:68449916-68449938 CTTGATGCCCCAGGGGCAATGGG - Intergenic
1132802084 16:1759457-1759479 CACGAGGCCCCAAGTGGACCTGG - Intronic
1133405842 16:5523850-5523872 CATGCTGCCCCAAGGACACCTGG - Intergenic
1137021470 16:35432429-35432451 CTGGATGCCTCAAGGGGAAAAGG - Intergenic
1137559627 16:49494370-49494392 CTTGATGCCCCAAGGGGACCAGG + Intronic
1137665490 16:50246691-50246713 CTCGGTGGCCAAAGGGGACCAGG + Intronic
1138630804 16:58292959-58292981 CTTGCAGCCCCAAAGAGACCAGG - Intronic
1140259472 16:73364996-73365018 CCAGATGCCCCAAGGGCACATGG - Intergenic
1141901940 16:86996661-86996683 CTTGAGGCCACATGGGGCCCCGG + Intergenic
1141935795 16:87237013-87237035 CAGGGTGCCCCCAGGGGACCTGG - Intronic
1143679613 17:8466786-8466808 CCTGATGGCCCAAGGGGCACTGG - Intronic
1146159089 17:30550142-30550164 CTTCATGCCCTAAGGTGGCCTGG + Intergenic
1147728842 17:42584280-42584302 CTGGCTGCCCCAAGGGGACTTGG + Intronic
1152299067 17:79484920-79484942 CTGAAAGCCCCAAGGGGACCAGG - Intronic
1152856620 17:82668356-82668378 CTTGAAGCTTCAAGGGGGCCTGG - Intronic
1154383225 18:13871014-13871036 CTTTGGGCCCCAAGGAGACCAGG + Intergenic
1159085222 18:63782492-63782514 CTTGAGCGCCCAAGCGGACCAGG - Exonic
1160838724 19:1136899-1136921 CCTGCAGCCCCATGGGGACCCGG + Intronic
1160942220 19:1625643-1625665 CTTCATGCCCGAAGGGGACAGGG + Exonic
1161622629 19:5306683-5306705 AATGCTTCCCCAAGGGGACCTGG - Intronic
1163318176 19:16555644-16555666 CTTGGTGCCCTTTGGGGACCTGG - Intronic
1164421450 19:28096884-28096906 CATGAAGCCCTAAGGGGACTTGG - Intergenic
1166891895 19:45999187-45999209 GTTGATGCCCCAGGGGGAACTGG + Intronic
1167380857 19:49137169-49137191 CTTGATGCATCAAGAGGAACTGG - Intronic
1167530552 19:50013339-50013361 CATGATGCCCTAAGGGACCCAGG - Intronic
927215386 2:20665680-20665702 CTCAATGCCCCAAGGTGAGCAGG + Intergenic
932564393 2:72896445-72896467 CTCGGTGCCCCAGAGGGACCTGG - Intergenic
943820668 2:192315735-192315757 CTTGCTGCCCCATGGGGCCCAGG + Intergenic
1169656380 20:7928955-7928977 CTTGATGACCCAAGGGAGCAGGG - Intronic
1170036250 20:11993198-11993220 TTTGATGACAAAAGGGGACCAGG + Intergenic
1172898239 20:38315654-38315676 CTTGAAGTCCTAAGAGGACCTGG - Intronic
1174855232 20:54038377-54038399 CTGTAAGCCCCAAGTGGACCCGG + Intronic
1175508056 20:59501133-59501155 CTTGATGTCACATGGGGCCCTGG - Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175797124 20:61778776-61778798 CTTTATGTCCCCAGGGGAACTGG + Intronic
1180895766 22:19331165-19331187 CTTGCTGGCCCCAGGGCACCTGG + Exonic
1183342126 22:37287244-37287266 GATGAAGCCCCATGGGGACCAGG + Intronic
1183597433 22:38821233-38821255 GGTGATGACTCAAGGGGACCAGG + Exonic
1185206594 22:49542206-49542228 CTTTAGGCCCCAAGAGGCCCAGG + Intronic
950094738 3:10322221-10322243 CTTAATGTCACAAGGGGCCCAGG - Intergenic
952541959 3:34376235-34376257 CTAGGTGCCCCAAGAGAACCAGG - Intergenic
953003586 3:38957447-38957469 CTTCATGGCCCAAGGGGATTGGG - Intergenic
960522201 3:118668057-118668079 CTTCCTGCCCCATGGGGTCCAGG - Intergenic
968531369 4:1093739-1093761 CTTCTGGCCCCAAGGGGACTTGG + Intronic
968555335 4:1244066-1244088 CTTGATGCCTCCAGAGAACCTGG - Intronic
973034590 4:45390464-45390486 CTTGATCCCTCTAGGGCACCAGG - Intergenic
977914544 4:102577060-102577082 CTTGATCCTCCAAGGGGTCCAGG + Intronic
981135223 4:141203565-141203587 CTAGATACCCCAAAGGCACCAGG + Intronic
982031786 4:151308496-151308518 CATCTTGCCCCAAAGGGACCTGG + Intronic
996999474 5:129742048-129742070 CTGGAAGATCCAAGGGGACCAGG - Intergenic
999538609 5:152547316-152547338 CAAGATGCCCAAAGGGGAACTGG + Intergenic
1004799971 6:19135154-19135176 GTTCATGCCCCCAGGGGAGCAGG - Intergenic
1006039147 6:31239369-31239391 CCTGATGCCCCAAGTGCACAAGG + Intergenic
1006296520 6:33172350-33172372 CCTGGGGCCCCAGGGGGACCAGG + Exonic
1010020539 6:71154870-71154892 CCTGATGCCCCAAGGGAGACTGG + Intergenic
1016779679 6:147943953-147943975 CCTGATGGACCAAGGGCACCAGG + Intergenic
1019517935 7:1447855-1447877 CTTGGTGCCCGGGGGGGACCTGG + Intronic
1022507208 7:30914624-30914646 CTGGATGCCTCAAGAGGAGCAGG + Intronic
1022519717 7:30998344-30998366 CTTGATGGCCCCAGGGGTGCTGG - Intergenic
1026794937 7:73359953-73359975 GGTGATGCCACCAGGGGACCAGG + Intergenic
1037681245 8:21099352-21099374 TTTGATGCCACATGGAGACCAGG + Intergenic
1038701965 8:29857262-29857284 CTTGAGGCCACCAGGGAACCTGG - Intergenic
1039893458 8:41699667-41699689 CTTGATGCTGCAAGGAGACTGGG + Intronic
1041934332 8:63319741-63319763 GTTCATTCCTCAAGGGGACCCGG - Intergenic
1041942526 8:63404164-63404186 CCTGATGCTCCAAGAGGGCCAGG + Intergenic
1045404040 8:101847477-101847499 CATGATGCCACAAGGGACCCAGG - Intronic
1048574703 8:135681420-135681442 CTTGAGGCCCCAAAGTGGCCAGG + Intergenic
1049265929 8:141667907-141667929 CCTGCTGCACCCAGGGGACCTGG - Intergenic
1049310406 8:141931169-141931191 CTTGGTGGCCTAAGGTGACCTGG - Intergenic
1049500757 8:142963665-142963687 CTTGATGTCCCAAGATAACCTGG - Intergenic
1055197644 9:73615717-73615739 CTCAATGACCCAAGAGGACCTGG - Intergenic
1060920656 9:127418174-127418196 CCTGATGCCCCCCGGGGACCAGG + Intergenic
1060979230 9:127783208-127783230 CCTGAGGCCCCAAGGGGAAGTGG + Intergenic
1186544373 X:10433798-10433820 CCTGATTCCCCATGGGGAACGGG + Intergenic
1199602051 X:149546935-149546957 CTTCATGCCCCAAAGGGATCAGG - Exonic
1199648337 X:149932549-149932571 CTTCATGCCCCAAAGGGATCAGG + Exonic