ID: 1137562026

View in Genome Browser
Species Human (GRCh38)
Location 16:49508996-49509018
Sequence GGAGCTGTTGCCTTATTTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137562026_1137562029 12 Left 1137562026 16:49508996-49509018 CCGTGAAATAAGGCAACAGCTCC 0: 1
1: 0
2: 2
3: 8
4: 156
Right 1137562029 16:49509031-49509053 TCCTACCATGTGTCAGAAACTGG 0: 1
1: 0
2: 5
3: 25
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137562026 Original CRISPR GGAGCTGTTGCCTTATTTCA CGG (reversed) Intronic
901066267 1:6496187-6496209 GGAGCTGTAGCCTTATGTCACGG - Intronic
902635704 1:17733736-17733758 GCAGCTGTTGATTTATTTCTGGG + Intergenic
904389226 1:30170100-30170122 GGAGCTGCTGCCACATTCCAGGG + Intergenic
904862779 1:33551412-33551434 GGAGCTGTTGCAGTAGTTCAAGG + Intronic
905101300 1:35524635-35524657 GGATCCTTTGCCTTATCTCAAGG + Intronic
907393979 1:54177032-54177054 TGAGCTGTGGCCTGATGTCATGG - Intronic
908908754 1:69047638-69047660 AGACCTTTTGCCTTATTGCAAGG - Intergenic
917436179 1:175023558-175023580 GGAGCTCTCGCGATATTTCACGG + Intergenic
917553848 1:176063708-176063730 TTAGCTTTTGTCTTATTTCAGGG + Intronic
917912754 1:179668265-179668287 GCAGCTCTTGCCTCCTTTCATGG + Intronic
920065931 1:203269730-203269752 TGAGCTGCGGCCTGATTTCATGG + Intronic
920740016 1:208571862-208571884 AGAGCTGTTGACATATTTAAAGG - Intergenic
1063912669 10:10848340-10848362 GGCGCTGTTGCCATTTTTCAAGG - Intergenic
1063950646 10:11219831-11219853 GGAAATGTTGACTAATTTCAAGG - Intronic
1065539832 10:26752057-26752079 GGAGTAGTTTCCTTATTCCAAGG + Intronic
1066206938 10:33198786-33198808 GGAGCTGTTTACTTTTCTCAAGG + Intronic
1069061173 10:63895961-63895983 GCAGAAGTTCCCTTATTTCATGG + Intergenic
1074283710 10:112078629-112078651 GGAGCTGTTGCTTGATCTTATGG - Intergenic
1074654826 10:115573052-115573074 GGACCTTCTGCCTTATTGCAAGG + Intronic
1074888391 10:117713637-117713659 GTGGCAGTTGCCTTATTTAAGGG - Intergenic
1076311231 10:129509064-129509086 GGAGCAGTTGCGTCATTTCCGGG + Intronic
1080481473 11:32655584-32655606 GGAGCTAATGTGTTATTTCAGGG + Intronic
1082738616 11:56885192-56885214 TCAGCTGCTGCCTTATCTCATGG - Intergenic
1084786433 11:71444324-71444346 GGAGCTAATGCCTTCTGTCATGG - Intronic
1085346919 11:75774191-75774213 GGAGCTGCTGGCTGATTTGAGGG + Intronic
1085907180 11:80777577-80777599 ATTGCAGTTGCCTTATTTCAAGG - Intergenic
1090866273 11:130703632-130703654 GTAGCTGTTGCCTCAATTCATGG + Intronic
1092515946 12:9212394-9212416 GGAGCTGGTACCAGATTTCAAGG + Intergenic
1097333974 12:58361645-58361667 GGAGCAGTTGAGTTAGTTCAGGG - Intergenic
1100962964 12:99984334-99984356 GAAGCTCTTGCATTATTTTAGGG - Intronic
1101308299 12:103553403-103553425 GAAGCTGTTTCCTTGTTTTAAGG - Intergenic
1102759598 12:115374196-115374218 GGAGCTGTGGGCTTAGTTGATGG - Intergenic
1103316980 12:120064186-120064208 GGAGCTCTTCCCTTAACTCAAGG + Intronic
1105026218 12:132850914-132850936 GGAGCTTGTCCTTTATTTCATGG - Intronic
1109378512 13:61526565-61526587 GGACCGTCTGCCTTATTTCAAGG + Intergenic
1109880206 13:68463333-68463355 GGTGTTGTAGCTTTATTTCAGGG - Intergenic
1112015472 13:95327823-95327845 GAAAATGTTGCTTTATTTCATGG + Intergenic
1114392638 14:22326676-22326698 AGATCTGTTGCCTCAATTCAGGG - Intergenic
1114394670 14:22346624-22346646 GTAGTTGTAGCCTTATTTCTGGG + Intergenic
1115044669 14:28976963-28976985 GGAGAGGTTGCCGTATCTCACGG + Intergenic
1116487593 14:45469329-45469351 GTAGCTTTTGCCTTGTTTCTGGG + Intergenic
1117195443 14:53335789-53335811 GAAGATGTTGCCTTATATCTAGG + Intergenic
1123157460 14:106242329-106242351 AGAGCTGTAGCCTTTTCTCAAGG - Intergenic
1126794866 15:52252378-52252400 GGAGGTATGCCCTTATTTCAAGG - Intronic
1130850132 15:87784695-87784717 TGAGCTGGGGCCTTATTTCCAGG + Intergenic
1131327127 15:91458796-91458818 GGAGCTGATAACTTATTCCAAGG + Intergenic
1132618718 16:854564-854586 GGAGCTGAGGCCCTACTTCAGGG - Exonic
1133981254 16:10634859-10634881 GGGGCTGTGGTCTTATCTCAAGG - Intronic
1137562026 16:49508996-49509018 GGAGCTGTTGCCTTATTTCACGG - Intronic
1144588818 17:16506278-16506300 TGTGCTCTTGCCTTTTTTCATGG + Intergenic
1145908761 17:28530824-28530846 GGAGCACTTTCCTTACTTCAAGG + Exonic
1146590133 17:34121627-34121649 GGAGCTGTTGTGACATTTCAAGG - Intronic
1151122961 17:71813330-71813352 GTAGGTGTTGCTTTATTTCTGGG - Intergenic
1153710090 18:7789917-7789939 GAAGCTACTGCCTCATTTCAGGG - Intronic
1154474069 18:14735708-14735730 GAAACTGTTCCTTTATTTCAGGG + Intronic
1155081898 18:22418767-22418789 GGAGATGATGACTTATTGCAGGG - Intergenic
1157712521 18:49859747-49859769 AGAGCTCTTGGCTTTTTTCAAGG - Intronic
1157744833 18:50126240-50126262 GGACCTGTTTCCCTGTTTCAGGG - Intronic
1157886463 18:51371438-51371460 GGAGCTGTTGCACAAATTCAGGG + Intergenic
1166127851 19:40726659-40726681 GGGGGTCTTGCCTTATTTCCAGG - Intronic
1167391269 19:49196668-49196690 GGAGCTGCTGCTCTATTTCTGGG + Exonic
925525014 2:4790272-4790294 GGAGCTACTGCCTTGATTCATGG + Intergenic
926254611 2:11180075-11180097 GAAGCTGAAGCCTTATTCCAGGG + Exonic
926436264 2:12841259-12841281 GGAGCTGCTGCCGTATTGTAAGG + Intergenic
929329462 2:40663141-40663163 GAAGATGATGCCTTATTCCAGGG + Intergenic
932484875 2:72078668-72078690 GGTGCTGTTGCCAGATTGCAAGG - Intergenic
932885735 2:75547713-75547735 GGAGCTATTGCTTTAATTCAGGG - Intronic
932989154 2:76764973-76764995 GGAGCTGTCGCCTAAAGTCATGG + Intronic
934559301 2:95304342-95304364 ATCGCTGCTGCCTTATTTCATGG - Intronic
939477664 2:142707426-142707448 GGAGCTGTTTTCTTCTTTCTTGG - Intergenic
939644687 2:144683145-144683167 GCAGCTGTTGCCTCATTTTGAGG + Intergenic
943093427 2:183400793-183400815 GGTGTTGTGGTCTTATTTCAGGG + Intergenic
946688857 2:222295963-222295985 TAAGCAGTTGCCTTATTTCCAGG - Intronic
1169756963 20:9052976-9052998 GCAGCTGATGGCCTATTTCAAGG + Intergenic
1171837251 20:30168419-30168441 GTAGCTGTGGACTTATTTAAAGG - Intergenic
1172825363 20:37778613-37778635 GGAGCTGGGGCTTTAATTCATGG - Intronic
1175646168 20:60673736-60673758 GGAGCTTCTGCCTCATCTCATGG - Intergenic
1177804108 21:25856968-25856990 TGAAATGTTTCCTTATTTCATGG + Intergenic
1177907332 21:26987772-26987794 GTAACTGTTGCCTTATTTGTGGG - Intergenic
1185040432 22:48501205-48501227 GGAGCTGTGGCCTGAATGCATGG + Intronic
951950545 3:28195634-28195656 GGAGATGTGGCCATATGTCAAGG + Intergenic
953072971 3:39541519-39541541 GTAGCTGATGTCTTAGTTCAAGG + Intergenic
955215090 3:56978772-56978794 GGAGCTGTACCCTTATTGCTAGG - Intronic
958774018 3:98459444-98459466 GTAGGTGTGGCCTTATTTCTGGG + Intergenic
959194542 3:103162898-103162920 TGCCCTTTTGCCTTATTTCATGG - Intergenic
960356147 3:116655895-116655917 TGGGCTGTTCACTTATTTCAGGG - Intronic
961127211 3:124430583-124430605 AGAGCTGTTGCCTCCTCTCATGG - Intronic
962587797 3:136860347-136860369 GTAGCTGTTGCCCAGTTTCATGG + Intergenic
963531860 3:146481014-146481036 GGAGCTGTTGAATTTTTTGAAGG - Intronic
964665856 3:159171194-159171216 AGAGATGTTGGCTAATTTCATGG - Intronic
966815079 3:183883864-183883886 GGAGCCATTGCCTAATCTCAAGG - Intronic
967638637 3:191834923-191834945 GGGGCTGTTGCCTTTTTTTCAGG - Intergenic
973743466 4:53940632-53940654 GTAGATGTGGCCTTATTTCTGGG - Intronic
976292083 4:83429770-83429792 GGAGCATTTTCCTTAATTCAAGG + Intronic
980240801 4:130172325-130172347 GGAACTGTTGGCTTCTTTCTAGG - Intergenic
981322497 4:143409123-143409145 GGAGCTGATGCCTTATCTCAGGG + Intronic
982817286 4:159902050-159902072 TGATCTGTTTCCTTGTTTCATGG - Intergenic
983685969 4:170409543-170409565 AGAGCTGTTGCCTTTTCTGAAGG + Intergenic
985530716 5:432604-432626 GGAGATGTTGGCGTATTCCATGG + Intronic
985695376 5:1337174-1337196 GGAGCTGTGGCGTTGTTTCACGG - Intronic
987505242 5:18761292-18761314 GAACCTGTTCCTTTATTTCAGGG + Intergenic
988611311 5:32728607-32728629 TGAGCTGTTTTCTTATTTCAAGG - Intronic
990098211 5:52146424-52146446 GTAACTGTTGTCCTATTTCAAGG + Intergenic
990893320 5:60671375-60671397 GGAGCTGTTGGCTTCTTGGAGGG - Intronic
991030611 5:62078324-62078346 GGGGCTGCTGCTTTAGTTCAGGG - Intergenic
995552405 5:113294347-113294369 GGAGTCGTTTCCATATTTCATGG + Intronic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
997303080 5:132820490-132820512 GGAGGTGTGGCCTTATTTTTGGG + Intergenic
998536338 5:142934664-142934686 AGTGTCGTTGCCTTATTTCAGGG + Intronic
999233371 5:150076046-150076068 TGAGCTGCTGCCTTGCTTCAGGG + Intronic
999238882 5:150115919-150115941 GGAGGTGTTGACTTCATTCAGGG + Exonic
999329760 5:150664750-150664772 AGAGCTGTTTCTTTATTACATGG + Intronic
1002111927 5:176921718-176921740 GTGGCTGTTGCATTATTCCAGGG - Intronic
1007737477 6:43990662-43990684 GCAGCTCTTGCCTTCTTCCATGG + Intergenic
1008150688 6:47948091-47948113 GGAGCTGTGGTCTTAGCTCAAGG + Intronic
1008371962 6:50742820-50742842 GGTGCTGTAGCATTATTTGATGG + Intronic
1008782704 6:55126742-55126764 GGGGCTGCTGCCTTATTTTCAGG + Intronic
1008876498 6:56335407-56335429 GGAGCTGTGGCTTAATTTCTGGG - Intronic
1010014317 6:71086608-71086630 AGACCCTTTGCCTTATTTCAAGG - Intergenic
1012169827 6:96003151-96003173 GGAGCAGTGGCCGCATTTCAGGG - Intergenic
1014683631 6:124466550-124466572 AGGGCTGCTGCCTTCTTTCAAGG - Intronic
1016171688 6:141025726-141025748 GGATCTCTTGCCTTATGTCTGGG + Intergenic
1021268284 7:18552539-18552561 GAAGCTGCTTCTTTATTTCAGGG + Intronic
1023378335 7:39580569-39580591 GAAGCTGTTGAGTTAGTTCAAGG + Intronic
1024424148 7:49206439-49206461 TGAGCTCTTTCCTTACTTCAGGG + Intergenic
1027889611 7:83954006-83954028 AGAGATGTTCCCTTATTTCTAGG + Intergenic
1028858329 7:95617684-95617706 GTAGGTGTGGCCTTATTTCTGGG - Intergenic
1029359640 7:100079274-100079296 GGAGCTGTTGCCTTTTTCTCTGG - Intronic
1032858839 7:135858928-135858950 GGAGCTGGGGCCATACTTCAGGG - Intergenic
1033203070 7:139391229-139391251 GCAGCTGTTGCTTTAGTTTAAGG + Intronic
1035376696 7:158411306-158411328 GGAGATGTCACCTCATTTCAAGG - Intronic
1035421513 7:158732743-158732765 GGAGCTTTTAGCTTGTTTCATGG - Exonic
1037182157 8:16020304-16020326 GCAGCTTTTGTGTTATTTCATGG + Intergenic
1037536941 8:19833512-19833534 AGTACTGATGCCTTATTTCAGGG - Intronic
1042060518 8:64811939-64811961 GCAACTTTTGGCTTATTTCAGGG - Intergenic
1046855740 8:119029688-119029710 GGACCTGTTCCCTAGTTTCAAGG + Intronic
1048409332 8:134155608-134155630 GGAACAGTGGCCTTATATCAAGG + Intergenic
1051650287 9:19316794-19316816 GCAGCTGTGGCTTTATTTGAAGG - Exonic
1053602163 9:39621913-39621935 GAAGCTGTTGCCTTAAGACAAGG - Intergenic
1053859817 9:42375678-42375700 GAAGCTGTTGCCTTAAGACAAGG - Intergenic
1054251372 9:62720520-62720542 GAAGCTGTTGCCTTAAGACAAGG + Intergenic
1054565484 9:66755038-66755060 GAAGCTGTTGCCTTAAGACAAGG + Intergenic
1057345145 9:94243528-94243550 GTAGGTGTGGCCTTATTTCTGGG + Intergenic
1057985549 9:99710079-99710101 GGAGCTCTTTCCTTATTTCTAGG - Intergenic
1062584632 9:137243748-137243770 GGTGCTGTTGCCGAATGTCAGGG + Exonic
1186094924 X:6090084-6090106 GGAGGTGTTACCTTAGCTCAGGG - Intronic
1186366592 X:8901227-8901249 GGAGGTGTTTGCTTCTTTCATGG - Intergenic
1187814813 X:23219719-23219741 TTCACTGTTGCCTTATTTCAAGG - Intergenic
1188869210 X:35352939-35352961 GGAGCAGGTGCTTAATTTCAAGG + Intergenic
1189092680 X:38103601-38103623 GGAGATCTTGCTTTATTTCTTGG + Intronic
1189300121 X:39946489-39946511 GGAGGTGCTGCCTCCTTTCAGGG - Intergenic
1190693049 X:52928014-52928036 AGAGCTGTTGCCTTAGAGCAAGG + Intronic
1193456786 X:81741416-81741438 GGATGTGTGGCCTTATTTCTGGG + Intergenic
1194412853 X:93578079-93578101 GGAGCTGGGGCCATGTTTCAGGG + Intergenic
1195925931 X:110024589-110024611 GGAGCTGTTATTTAATTTCAGGG + Intronic
1197148167 X:123191463-123191485 GGGGCTGCTGCCTTAGCTCAAGG - Intronic
1198322208 X:135529368-135529390 GGAGCCCTTGTCTTATATCATGG + Intronic
1199538212 X:148927699-148927721 TGAGATGTTGACTTCTTTCATGG + Intronic
1199685945 X:150265794-150265816 GGAGAGGCTGCCTAATTTCATGG + Intergenic
1199952282 X:152715780-152715802 GGAGCTGTCTGCTCATTTCAGGG + Intronic
1199954911 X:152734971-152734993 GGAGCTGTCTGCTCATTTCAGGG + Intronic
1199957401 X:152752668-152752690 GGAGCTGTCTGCTCATTTCAGGG - Intronic
1200855804 Y:7936954-7936976 AGAACTTTTGCCTTATTTCAGGG - Intergenic
1201463387 Y:14253543-14253565 GGAGTTGTTGGCTTATGTCCTGG + Intergenic
1202263508 Y:22994209-22994231 AGATCTTTTGCCGTATTTCAGGG + Intronic
1202416498 Y:24627950-24627972 AGATCTTTTGCCGTATTTCAGGG + Intronic
1202454289 Y:25042136-25042158 AGATCTTTTGCCGTATTTCAGGG - Intronic