ID: 1137563354

View in Genome Browser
Species Human (GRCh38)
Location 16:49517016-49517038
Sequence GCTCCTCTGTACAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137563354_1137563361 26 Left 1137563354 16:49517016-49517038 CCTTCCTCCTTGTACAGAGGAGC 0: 1
1: 0
2: 4
3: 20
4: 215
Right 1137563361 16:49517065-49517087 GGACAATAAAAGCCAGAAAGAGG 0: 1
1: 0
2: 1
3: 56
4: 516
1137563354_1137563360 5 Left 1137563354 16:49517016-49517038 CCTTCCTCCTTGTACAGAGGAGC 0: 1
1: 0
2: 4
3: 20
4: 215
Right 1137563360 16:49517044-49517066 AAGTCAGGCTGTAGAGAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 343
1137563354_1137563357 -10 Left 1137563354 16:49517016-49517038 CCTTCCTCCTTGTACAGAGGAGC 0: 1
1: 0
2: 4
3: 20
4: 215
Right 1137563357 16:49517029-49517051 ACAGAGGAGCCCAGAAAGTCAGG 0: 1
1: 1
2: 3
3: 35
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137563354 Original CRISPR GCTCCTCTGTACAAGGAGGA AGG (reversed) Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900620855 1:3586985-3587007 CCACCTGTGTGCAAGGAGGAAGG + Intronic
901312667 1:8281583-8281605 GCACCTCTTTACAAGGTGGAAGG - Intergenic
902007628 1:13244994-13245016 GCTACTCTGCACATGGAGGTGGG - Intergenic
902700218 1:18167348-18167370 CCTCCTCTGTACAATAAGGCCGG - Intronic
903175692 1:21578821-21578843 GCTCCTCTGGACACTGAGGCAGG + Intergenic
903438664 1:23370909-23370931 GCTCCTTGGAGCAAGGAGGAGGG + Exonic
904203616 1:28838001-28838023 CCTCCTCTGTACACTGAGGATGG + Intronic
904703983 1:32376736-32376758 GCTCCTCTGTAGAGAGAGAAAGG + Exonic
905662624 1:39739003-39739025 GCATCTCTGAACCAGGAGGACGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
909622337 1:77682847-77682869 GCTTTTCTGTACAAGGGGAAAGG - Intronic
912225048 1:107723692-107723714 GCTCCTCTGTATAGGGTGGCTGG - Intronic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
916312510 1:163412614-163412636 CCAACTCTGGACAAGGAGGAAGG + Intergenic
916969470 1:169996223-169996245 GATCCTCTGTTAAAGCAGGAAGG - Intronic
917526343 1:175791702-175791724 GAGCTTCTGTACAATGAGGAGGG + Intergenic
917966492 1:180182369-180182391 GCCCCTCTGGGCAAGAAGGAAGG - Intronic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
923919138 1:238544655-238544677 GCTACTCTGGGCAAGGAAGAAGG - Intergenic
924441134 1:244086405-244086427 GCATCTCTGTAAGAGGAGGAAGG - Intergenic
924496608 1:244596361-244596383 GCTGCTCTGTAGACGGAGCAGGG - Intronic
1063189563 10:3680597-3680619 GCTGCTGTGTACAAGGAGAGTGG - Intergenic
1067080762 10:43211041-43211063 CCTCCTCTGTTCAGGCAGGAAGG + Intronic
1067185708 10:44025344-44025366 GCCCCTCTGTAGAATGAGGATGG + Intergenic
1067726597 10:48775303-48775325 GCTCCTGTGTATAAGCAGCAGGG - Intronic
1068313182 10:55305869-55305891 GTTCATGTCTACAAGGAGGAAGG - Intronic
1071394275 10:85206256-85206278 GCTCACCTGGACAAGGAGGCGGG + Intergenic
1071505516 10:86229259-86229281 GCTCCTCTGCCCTGGGAGGAGGG - Intronic
1073053997 10:100687428-100687450 GCTCCTCTCTGGGAGGAGGAAGG - Intergenic
1073069765 10:100785923-100785945 TCTCCTCTGTAAAATGAAGATGG + Intronic
1073207847 10:101778123-101778145 CCTACTGTGTACAAGGATGAGGG - Intronic
1073295417 10:102435670-102435692 GCTCTTCTGAGAAAGGAGGAAGG - Intergenic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1075208894 10:120473860-120473882 GTTCCACTGTACAGGGAGCATGG - Intronic
1075336361 10:121611791-121611813 GCACCTCTGTAGCAGGAGGTTGG - Intergenic
1078332957 11:10441025-10441047 ACTCCCCTGAAGAAGGAGGAGGG + Intronic
1078761863 11:14258114-14258136 GCTCTTCAGTAAAAGAAGGAGGG - Intronic
1080489898 11:32751217-32751239 TCTCCTCTCTTCAAGCAGGAAGG + Intronic
1080779403 11:35417592-35417614 ACACCTGTGTACAAGGAGGGTGG - Intronic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1082226682 11:49715940-49715962 CCTCCTCTATATAATGAGGATGG - Intergenic
1083448857 11:62728870-62728892 GCTCAGCTGTACAAGGAGGAAGG + Exonic
1085784889 11:79440342-79440364 GCTCCCCTGGCCCAGGAGGAGGG - Intronic
1088117118 11:106325094-106325116 TCTGCTCAGTAAAAGGAGGATGG - Intergenic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1091750200 12:3017574-3017596 GCTCTTCTGAACAGGGAGGAGGG - Intronic
1094202908 12:27811359-27811381 GCTCTACTGTATAAGGAGCAGGG + Intergenic
1094481483 12:30885752-30885774 GCTCCACTTTCCAAGGAGGCAGG - Intergenic
1096009399 12:48200301-48200323 GCTCTTCTTAACAAGGAGAAAGG - Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1097868329 12:64578545-64578567 GCTCCTCTGGACACTGAGGTGGG + Intergenic
1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG + Intergenic
1102735961 12:115159723-115159745 TCTCCTCTGTACAATGAAGATGG + Intergenic
1102776597 12:115524988-115525010 TCACCTCTGTAGAGGGAGGAGGG + Intergenic
1102854170 12:116278180-116278202 TCTCCTCTGCAAAAGGCGGACGG - Intergenic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1103163684 12:118752330-118752352 GCTCCTCTGTCCAATGGGCAGGG + Intergenic
1104676930 12:130717334-130717356 GGTCCTTTGTACAAAAAGGAAGG + Intergenic
1106732171 13:32552634-32552656 GCACCTCTGTTCAAAGATGAGGG - Intergenic
1106750200 13:32756349-32756371 CTTCCTCTGTAGAAGGAGAATGG + Intronic
1109283134 13:60380062-60380084 TCTCCTCTGTACCAGGAAGTGGG - Intergenic
1114407453 14:22470149-22470171 ACTCCTCTGTGTAAAGAGGAAGG + Intergenic
1114654591 14:24308488-24308510 CCTCCTCCGACCAAGGAGGAAGG - Exonic
1115961360 14:38838175-38838197 GCGCCTCTGCACCAGGAGGAAGG + Intergenic
1118909591 14:70050128-70050150 CCTCCTTTGTAAAAGGAGCAGGG + Intronic
1119061405 14:71478845-71478867 GCTCCTCTGATCAGAGAGGAAGG + Intronic
1119996950 14:79263587-79263609 TCTCCTCTGTAAAATGAGGGAGG + Intronic
1120030630 14:79636810-79636832 GCTCCTCTGCCAAAGGAGCATGG + Intronic
1121776292 14:96593171-96593193 GCTCCCCTGGACACGGAGGGTGG + Intergenic
1121812557 14:96904127-96904149 GCTCCTCTGTACATGAAGGCAGG + Intronic
1122024135 14:98862594-98862616 TCTCCACTGTCCAAGGAAGATGG + Intergenic
1122252764 14:100451650-100451672 GCTCTTCTGTAAAACAAGGATGG - Intronic
1126865676 15:52934248-52934270 GCTACTGTGTCCAAGGAGGATGG + Intergenic
1127638535 15:60893721-60893743 GCTCCTGTGTACAAGGGAAAGGG + Intronic
1128982797 15:72198884-72198906 GCGCCTCTGCACCAGGAGGTGGG + Intergenic
1129208263 15:74050228-74050250 GCTCCTCTGTAGGAGGAAGATGG - Intergenic
1129755848 15:78098529-78098551 GCTTTTCTGTGCATGGAGGAAGG - Exonic
1130518464 15:84644343-84644365 GCTCTTCAGTACCAGGAAGATGG - Intronic
1130911750 15:88275694-88275716 GCTCCTCTGAAAAATAAGGATGG + Intergenic
1133298932 16:4769840-4769862 ACTCCTTTGTACAATGGGGATGG + Intergenic
1133378577 16:5310515-5310537 CCTCATCTGTATATGGAGGAGGG + Intergenic
1133427014 16:5701449-5701471 CATCCTTTGTACATGGAGGAAGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133921675 16:10159129-10159151 CCTCCTCTCTACAATGAGGGTGG + Intronic
1134505781 16:14805726-14805748 GCTCCTGTGAGCAAAGAGGATGG + Intronic
1134574800 16:15323221-15323243 GCTCCTGTGAGCAAAGAGGATGG - Intergenic
1134727645 16:16433253-16433275 GCTCCTGTGAGCAAAGAGGATGG + Intergenic
1134939787 16:18278574-18278596 GCTCCTGTGAGCAAAGAGGATGG - Intergenic
1135938112 16:26798183-26798205 GCTCATCTCTACAGGGAGGCAGG - Intergenic
1136685841 16:31994566-31994588 GCACCTCTGTCCCAGGAGGCAGG + Intergenic
1136786454 16:32938099-32938121 GCACCTCTGTCCCAGGAGGCAGG + Intergenic
1136883318 16:33915696-33915718 GCACCTCTGTCCCAGGAGGCAGG - Intergenic
1137008610 16:35301443-35301465 GATTCTATGTACAAGTAGGATGG - Intergenic
1137563354 16:49517016-49517038 GCTCCTCTGTACAAGGAGGAAGG - Intronic
1137577355 16:49609069-49609091 TCTCCACTATACCAGGAGGATGG - Intronic
1137814313 16:51383806-51383828 GATCCTCTGGACCAGGAGGTTGG - Intergenic
1139851511 16:69953425-69953447 GCTCATCTGTAAACGGAGCAGGG - Intronic
1139880487 16:70176337-70176359 GCTCATCTGTAAACGGAGCAGGG - Intronic
1140372023 16:74419180-74419202 GCTCATCTGTAAACGGAGCAGGG + Intronic
1141771637 16:86093208-86093230 CCTCCTCTCTACATAGAGGATGG - Intergenic
1141934537 16:87228557-87228579 GCTCCTGTGTACAGGGTGGGTGG - Intronic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1142236096 16:88923278-88923300 CCTCCTCTGTGCGATGAGGAGGG - Intronic
1142252928 16:89000963-89000985 GCTCCTCGTTAGAAGGAGAAAGG - Intergenic
1142376304 16:89708732-89708754 GCTGCACTGTAGAAGCAGGAGGG - Intronic
1203088688 16_KI270728v1_random:1199765-1199787 GCACCTCTGTCCCAGGAGGCAGG + Intergenic
1143137086 17:4718006-4718028 GCTTCCCTGGACAAGGAGGTGGG + Exonic
1143368258 17:6422411-6422433 CCTCCTCTGCACTAGGAAGATGG + Intronic
1143780795 17:9228273-9228295 GCTCCTCGGTGGAGGGAGGAAGG + Intronic
1144769357 17:17750985-17751007 CCTCCTCTGTGGAAGGCGGAAGG - Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1147146795 17:38490224-38490246 GCACCTCTGTCCCAGGAGGCAGG + Intronic
1147625886 17:41899604-41899626 GTCTGTCTGTACAAGGAGGAGGG - Intronic
1147630977 17:41931410-41931432 GCTGCTCTGTGGAAGGAGGCCGG - Intronic
1148741135 17:49893459-49893481 CCTCCTCTGTACAAGGTGCTGGG - Intergenic
1152711431 17:81872047-81872069 GCTCCTCAGGACCAGGAGGCAGG + Intergenic
1152879588 17:82807591-82807613 GCTGCTCTGTAGGAAGAGGAAGG - Exonic
1155277687 18:24204763-24204785 GCTCCTCTGTCTTAGGAGAAAGG - Intronic
1155385878 18:25276581-25276603 GCTCCACTGTTCAGGGAGGTGGG - Intronic
1155413684 18:25572746-25572768 GCTCCTCTTTACAGGGTGGTAGG + Intergenic
1159327583 18:66943211-66943233 CCTCCTCTGTGCCACGAGGAAGG - Intergenic
1159948301 18:74459826-74459848 GAAGCTCTGTGCAAGGAGGAGGG - Intergenic
1161248290 19:3267211-3267233 GCTCCCCTGTGCCAGGATGAGGG - Intronic
1161814264 19:6489788-6489810 GCTCCTTTGTATAGGGAGAAAGG - Intergenic
1162461906 19:10818418-10818440 CCTCATCTATCCAAGGAGGATGG - Intronic
1162686797 19:12393429-12393451 CCTCCTCTGTACATGTGGGATGG - Intronic
1162691149 19:12433203-12433225 CCTCCTCTGTACATGTGGGATGG - Intronic
1163753171 19:19090767-19090789 CCTCCCCTGTACCTGGAGGAGGG - Intronic
1166546171 19:43635901-43635923 GCTCCTGGGTCCAGGGAGGAGGG - Intronic
1167494048 19:49807705-49807727 GCCCCACTGTACAAGGCGGGTGG + Intronic
1168337255 19:55603664-55603686 GGTCCTCAGGACAAGGAGGTGGG - Intergenic
925240134 2:2317947-2317969 GCTCCCCAGTCAAAGGAGGAAGG + Intronic
925911196 2:8574654-8574676 GGACCTGTGTCCAAGGAGGAAGG + Intergenic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
927432838 2:23041591-23041613 GCTCCTAAGGACAAGGAGCAGGG + Intergenic
930667544 2:54114856-54114878 GCTCTTCTGTACAGTCAGGAAGG - Intronic
930705053 2:54496782-54496804 GGCCCTCTGTACAAGGTTGATGG + Intronic
931500038 2:62855451-62855473 GTTCCTGGGTAGAAGGAGGAAGG + Intronic
932307946 2:70717080-70717102 GTTCCTCTGTGCAGAGAGGAGGG - Intronic
932793091 2:74672739-74672761 CCTCCACTGTACTAGGAGGGAGG + Intronic
936467170 2:112764165-112764187 GGTCCTCTGTGCCAGGAGGCGGG - Intronic
937156627 2:119724566-119724588 GATCCTCTGAAAAATGAGGATGG + Intergenic
937207043 2:120243470-120243492 GCTCTCCTGCACCAGGAGGATGG - Intronic
938800656 2:134760622-134760644 GCTTATCTGTACAGGGAGCATGG + Intergenic
946413039 2:219525000-219525022 GCTCATCTGTAAAAGGGGAATGG - Intronic
946695098 2:222348813-222348835 GCTGCTCTGGAAAAGGAGGTGGG - Intergenic
1172131563 20:32659495-32659517 GCTCATCTGTACAATGAAGATGG - Intergenic
1172311468 20:33921571-33921593 TCTCGTCTGTAAAATGAGGACGG - Intergenic
1172322184 20:34004162-34004184 CTTCCTTTGTACATGGAGGAGGG + Intronic
1172765411 20:37348173-37348195 GCCCCTCTCTTCTAGGAGGAAGG + Intronic
1175624968 20:60482406-60482428 GCTCATCTGTAAGAGGTGGACGG - Intergenic
1175962333 20:62643274-62643296 GCTCCCCTGACCAGGGAGGATGG + Exonic
1180091294 21:45534990-45535012 GCTTCTCTGAACAGGGAGGCGGG + Intronic
1182131039 22:27850864-27850886 TCTCATCTATACAATGAGGATGG + Intergenic
1182663025 22:31938438-31938460 GCTCCTCTGAACAAGCTGGAGGG + Intronic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
1183653267 22:39171123-39171145 CCTCCACAGTACAGGGAGGAGGG + Intergenic
1184260134 22:43310226-43310248 GGTCCTCTGTCCAAGCAGAAGGG - Intronic
1184893531 22:47393735-47393757 CCTCCTCTGTCCAAGGAGACAGG + Intergenic
1185372932 22:50469292-50469314 GCTCCCCTGGGCCAGGAGGAGGG + Intronic
949471730 3:4403591-4403613 GCTTGTCTGTACAAGGCAGAAGG + Intronic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
953691578 3:45124398-45124420 CCTTCTCTGTCCAAGGAAGATGG + Intronic
955137912 3:56238333-56238355 CATCCTCTGAACAAGGAGAAGGG - Intronic
955727383 3:61947860-61947882 CCTCCTCTGAAAAAGGAGGCAGG - Intronic
960884731 3:122382981-122383003 GCTGCTCTGTAGGAGGAGGGAGG - Intronic
960997238 3:123348281-123348303 GCTCGTCTGTAAAATGAGGATGG + Intronic
966849570 3:184156134-184156156 GCTCCTCGGCAGGAGGAGGATGG - Intronic
966958286 3:184907863-184907885 GCAGCTCTGTGCAAGCAGGAAGG - Intronic
968753004 4:2399954-2399976 GCTCCCCTGTCTGAGGAGGAGGG - Intronic
969351140 4:6598527-6598549 GCTCATCCGTGCAATGAGGAAGG + Intronic
969613389 4:8238979-8239001 GCACCTCTACACAAGGAGGAGGG - Intronic
970030038 4:11663854-11663876 CCTCCTCTGATCTAGGAGGAAGG - Intergenic
971423754 4:26496550-26496572 TTTCCTCTGTTCAAGGAGAAGGG - Intergenic
972419155 4:38870028-38870050 GCTCCTCTGTAAAGCTAGGATGG - Intronic
973259263 4:48144775-48144797 TCTCATCTGTACAAGAATGATGG + Intronic
974943862 4:68503461-68503483 GCTGCTCTGTCCCAGGAGGTGGG - Intergenic
976683167 4:87780122-87780144 GCTCCTATATACATGGAGGGCGG - Intergenic
978142634 4:105335029-105335051 TCTCATCTGTACAATGATGAAGG + Intergenic
981301641 4:143193455-143193477 GCTACTCTGTATAAGTAGAATGG + Intronic
983839170 4:172435026-172435048 GCTCCTCAGTAAAAGGAGAATGG + Intronic
985952820 5:3236465-3236487 CCTCCTCTGTTCAAAGAGGAGGG + Intergenic
986116683 5:4782253-4782275 GCTCCTGGGTAAATGGAGGAAGG - Intergenic
988663605 5:33300840-33300862 GCTGCTCTGTTCAAGGAGAGTGG - Intergenic
989110451 5:37902109-37902131 CCTCCTCTCTAAAATGAGGAAGG + Intergenic
990884947 5:60580599-60580621 GCTCCTCTGTCAAAGCATGAGGG - Intergenic
992979756 5:82156545-82156567 GTTCCTCTGCTCTAGGAGGAAGG - Intronic
993465417 5:88240127-88240149 GCTCCTTTGTGGAAGGAGTAGGG + Intronic
995398663 5:111716808-111716830 GGTCCTCTGTCCCAGGAAGATGG + Intronic
1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG + Intergenic
1002252175 5:177936673-177936695 TCTCATCTGCACCAGGAGGACGG - Intergenic
1003366495 6:5479908-5479930 GCTCCTCAGGAGAAGGAGAAGGG + Intronic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004929380 6:20447123-20447145 GATCCTCTGAACACAGAGGAAGG + Intronic
1011485447 6:87836099-87836121 GCTCCTCTTGACAAGGACAAAGG - Intergenic
1012858380 6:104529177-104529199 GCTCCTCTGAGCAGAGAGGATGG - Intergenic
1016190769 6:141261496-141261518 GCTCCTCTGCAGAAAGGGGAGGG + Intergenic
1017817504 6:158026517-158026539 GCTCCTGGGTCCAGGGAGGAGGG - Intronic
1018826262 6:167409846-167409868 GCTCCTCCTTCCAAGGAGGCCGG + Intergenic
1018850822 6:167589084-167589106 GCTCCTCTGAAGGAGGAGGATGG - Intergenic
1019408780 7:897717-897739 TCTCCCGTGTACAAGGAGCATGG + Intergenic
1021749308 7:23779456-23779478 GGTGCTCTGTCCCAGGAGGATGG + Intronic
1022969748 7:35505948-35505970 GCTCCCCTGGACGAGGTGGATGG + Intergenic
1023782476 7:43669682-43669704 GCTCCCCTGTACAAAGATAAAGG - Intronic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035087457 7:156272995-156273017 GTTACTCTGTAAAGGGAGGAAGG - Intergenic
1035926890 8:3737541-3737563 GCTACTCTGTGCAAGGAGATTGG - Intronic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1037912118 8:22749695-22749717 GCTCCTCTGTAAAAGGCAGGGGG - Intronic
1040417764 8:47210418-47210440 GCTCCTCTGTGACAGCAGGAAGG + Intergenic
1040566166 8:48569835-48569857 CCTCCTCTAGACCAGGAGGATGG + Intergenic
1042847992 8:73187376-73187398 CCTCGCGTGTACAAGGAGGAAGG - Intergenic
1043501929 8:80866907-80866929 GCTCCTCCCTACTAGGAGGCAGG + Intronic
1047104479 8:121718447-121718469 GCTCCTTTGTTCAAGCAGCAAGG + Intergenic
1048468248 8:134685177-134685199 TCTCCTCTGTAAAAAGGGGATGG - Intronic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1055841572 9:80511978-80512000 GCTGCTTGATACAAGGAGGAAGG - Intergenic
1058766499 9:108187359-108187381 AATCCTCTGTACAAGGAGGAAGG + Intergenic
1058769504 9:108216603-108216625 GCTTCCCTGAACAAGGAAGAAGG - Intergenic
1058985605 9:110206762-110206784 GTTCCTCTGTTAGAGGAGGAAGG + Intronic
1059414599 9:114155344-114155366 CCCCATCTATACAAGGAGGAGGG + Intergenic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060375989 9:123115426-123115448 CCTCCTCTGTGCAGGGAGAAAGG - Intronic
1061519862 9:131111715-131111737 GGTCCTGTGTGCAAGGATGAGGG - Intronic
1061543926 9:131292940-131292962 TCACTTCTGTTCAAGGAGGAAGG - Intronic
1061641378 9:131959507-131959529 GGCCCTCTGTACAAGGAGGAGGG - Intronic
1185619573 X:1445225-1445247 AATCCTCTTTATAAGGAGGACGG - Intronic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1187031630 X:15493713-15493735 CCTCCTCTATAAAATGAGGATGG + Intronic
1188115164 X:26233560-26233582 TATGCTCTGTACAAGCAGGACGG - Intergenic
1196630027 X:117927386-117927408 GCTTCTCTGACCAAGGAGAAAGG - Intronic
1197655635 X:129113258-129113280 GCTGCTCTTTACTAGGTGGAAGG + Intergenic
1198388345 X:136148366-136148388 GTTCTTCTGTCCAAGGGGGATGG + Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic