ID: 1137563948

View in Genome Browser
Species Human (GRCh38)
Location 16:49521840-49521862
Sequence CGGGGGGATTCACCATTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137563948_1137563956 -3 Left 1137563948 16:49521840-49521862 CCATCTAATGGTGAATCCCCCCG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1137563956 16:49521860-49521882 CCGGTCCCCACACCCTCCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 170
1137563948_1137563963 18 Left 1137563948 16:49521840-49521862 CCATCTAATGGTGAATCCCCCCG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1137563963 16:49521881-49521903 GGCCTGTTTGCATATCCTCCAGG 0: 1
1: 0
2: 1
3: 12
4: 117
1137563948_1137563954 -4 Left 1137563948 16:49521840-49521862 CCATCTAATGGTGAATCCCCCCG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1137563954 16:49521859-49521881 CCCGGTCCCCACACCCTCCAAGG 0: 1
1: 1
2: 1
3: 33
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137563948 Original CRISPR CGGGGGGATTCACCATTAGA TGG (reversed) Intronic
902702024 1:18179039-18179061 GTGGGGGACTCACCAATAGATGG + Intronic
920970026 1:210735157-210735179 GAGGGGGCTTCACCACTAGAGGG - Intronic
923866064 1:237940791-237940813 CGGGGGCACTAATCATTAGAGGG + Intergenic
1064570906 10:16691984-16692006 TGGGGTGATTCACCATGAGGAGG - Intronic
1074895451 10:117773402-117773424 TGGGGGGATTTACAAATAGAGGG - Intergenic
1077178059 11:1199519-1199541 AGGGGGGCTTCACCCCTAGATGG + Intronic
1084019853 11:66410964-66410986 CCAGGGGACTCACCATTGGAGGG - Intergenic
1108806995 13:54170481-54170503 AAGGGGAATTCAGCATTAGATGG + Intergenic
1117505711 14:56401046-56401068 CAGTGGGACTCACCATTGGAAGG + Intergenic
1137563948 16:49521840-49521862 CGGGGGGATTCACCATTAGATGG - Intronic
1138138048 16:54540950-54540972 TGGGCGGATTCTGCATTAGAAGG - Intergenic
1140024523 16:71273201-71273223 CGGGGGGAATCCCAATAAGAAGG + Intergenic
1146809398 17:35891187-35891209 AGGGGGTATACACCAATAGAGGG - Intergenic
1160262441 18:77307408-77307430 CAGGGGAATTCCCCACTAGATGG - Intergenic
1164397260 19:27877118-27877140 GGGCAGGAATCACCATTAGATGG - Intergenic
1165160232 19:33811641-33811663 CGGGGGGCTTCACCGTTTCAGGG - Intronic
1165759118 19:38310255-38310277 TGGGTGGATGCATCATTAGATGG - Intronic
927442767 2:23130958-23130980 CAGGGGAATTCACACTTAGAGGG + Intergenic
941574896 2:167217347-167217369 CAGGGGGCTTTAACATTAGAAGG - Intronic
1170663703 20:18366686-18366708 AGGGAGGAGTCACCATTAGAGGG - Intergenic
956349409 3:68318229-68318251 CGAGGTGTGTCACCATTAGAAGG - Intronic
956860789 3:73321768-73321790 CGGGGGCATTTGCCATTTGATGG + Intergenic
963046107 3:141103845-141103867 CTGGAGGATTCAGAATTAGAAGG - Intronic
972195231 4:36646158-36646180 CGGGCGGTTACACCTTTAGAGGG - Intergenic
1001407218 5:171484589-171484611 GGTGGGGCTTCACCACTAGAGGG + Intergenic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1014450346 6:121574322-121574344 CTGGGGGATTATCCATCAGAAGG + Intergenic
1028190790 7:87849305-87849327 CAGGAGTATTCCCCATTAGAAGG + Intronic
1033407939 7:141088890-141088912 GTGGGGGATTCACTATTAAAAGG - Intronic
1046223020 8:111239943-111239965 CAGGGGCATTCATCATTAGTAGG + Intergenic
1194423750 X:93710324-93710346 CAGAGGAATTAACCATTAGAAGG - Exonic