ID: 1137565287

View in Genome Browser
Species Human (GRCh38)
Location 16:49528887-49528909
Sequence CGCCTGCGGGGTGAGAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137565287_1137565292 10 Left 1137565287 16:49528887-49528909 CCATCACTCTCACCCCGCAGGCG 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1137565292 16:49528920-49528942 CTCGTTCCACCCCAAGATGCAGG 0: 1
1: 0
2: 2
3: 7
4: 76
1137565287_1137565298 25 Left 1137565287 16:49528887-49528909 CCATCACTCTCACCCCGCAGGCG 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1137565298 16:49528935-49528957 GATGCAGGGTCCGCCGATAGTGG 0: 1
1: 0
2: 0
3: 6
4: 27
1137565287_1137565293 11 Left 1137565287 16:49528887-49528909 CCATCACTCTCACCCCGCAGGCG 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1137565293 16:49528921-49528943 TCGTTCCACCCCAAGATGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137565287 Original CRISPR CGCCTGCGGGGTGAGAGTGA TGG (reversed) Intronic
900206516 1:1434086-1434108 CGCCTGCTGGGCGAGGGTGGGGG + Intergenic
900860390 1:5224977-5224999 GGCCTGGGTGGTGGGAGTGATGG - Intergenic
903217111 1:21849328-21849350 GGCCTTGGGGGTCAGAGTGAGGG - Intronic
903328924 1:22586974-22586996 CGCCTGTGCGGAGAGGGTGAGGG + Intronic
903767201 1:25742481-25742503 GCCCTGCAGGGTGAGAGAGAGGG + Intronic
906143446 1:43546722-43546744 AGGCTGGGGGATGAGAGTGAGGG - Intronic
907242136 1:53086645-53086667 AGCCTGGGGTGTGAGAATGAGGG + Intergenic
908127326 1:61044062-61044084 GGCCTGGTGGGTGACAGTGAGGG + Intronic
909958339 1:81803356-81803378 AGACTGCGGGGTGGGGGTGAGGG + Intronic
919753780 1:201054050-201054072 CGTGTGCAGGGTGGGAGTGATGG - Intronic
920399779 1:205669641-205669663 AGCCTGCGGGGTCAGGGTGGGGG - Intronic
923905665 1:238381342-238381364 CGCCTGCTGTGTGTGAGAGAGGG - Intergenic
923915065 1:238492498-238492520 CGCCTGCTGGAAGACAGTGAGGG + Intergenic
1065101540 10:22336320-22336342 CGCCTGCGGGGCGGGGGTGGCGG - Intergenic
1067055168 10:43045802-43045824 TGCCTGCAGGGTGGCAGTGAGGG + Intergenic
1067534073 10:47095277-47095299 CGCCTGCCTGGTGAGAGGAAGGG + Intergenic
1069628067 10:69880483-69880505 CCCCTGCGGGGAGAGAGGAAGGG - Exonic
1075713829 10:124544578-124544600 CTCCTGCAGGGTGAGACTGTTGG - Intronic
1076123120 10:127952078-127952100 CCCCTGAGGTGGGAGAGTGAAGG - Intronic
1076715882 10:132363501-132363523 CGCCTGGGAGGTGCGAGGGAGGG - Intronic
1077368358 11:2170386-2170408 CGCCTGCGGGGTGGCACAGAGGG - Intronic
1078076656 11:8168561-8168583 AGCCAGCGGGGTAAGAGAGAAGG + Intronic
1079131089 11:17747359-17747381 CGCCTGCCAGGGGAGAGGGAGGG + Intronic
1083186653 11:61021720-61021742 TGCCTGCGGGGTGAGGGTTGGGG + Intergenic
1084657088 11:70525937-70525959 GGCCTGCTGGCTGAGAATGATGG - Intronic
1085079199 11:73620057-73620079 CGCCTGAAGTGTGATAGTGAAGG - Intergenic
1090349855 11:126101086-126101108 CTCCTGAGGGCTGAGAGAGATGG - Intergenic
1092409901 12:8244421-8244443 CTCCTGCGGGGTGGGATTGGGGG + Intergenic
1092761861 12:11818035-11818057 GGCCTGCGGGGTGACAGGGAGGG + Intronic
1096520195 12:52180681-52180703 TGCCTCCTGGGTGAGAGTGGGGG + Intronic
1097234005 12:57527651-57527673 AGCCTGCTGGGTGAGTCTGAGGG + Exonic
1099093286 12:78340154-78340176 CGGTTGGGGGGTGAGGGTGAGGG + Intergenic
1102192500 12:110999197-110999219 CGCCTGCAGGGTGAGACAGAGGG + Intergenic
1102795630 12:115686973-115686995 AACCTAAGGGGTGAGAGTGAGGG - Intergenic
1104410501 12:128553877-128553899 GGCCTGCGGGAGGAGAGGGAGGG + Intronic
1104414821 12:128589387-128589409 GGCAGGCGGGGTGAGAGGGACGG - Intronic
1104734952 12:131131021-131131043 TGGCTGCGGGGTTAGGGTGAGGG - Intronic
1104772206 12:131370366-131370388 CCCCTGAGGAGTAAGAGTGAAGG - Intergenic
1112019391 13:95358557-95358579 CACCAGTGGGGTGGGAGTGAGGG + Intergenic
1112302183 13:98240338-98240360 TGCCTGCGTGGTGATGGTGACGG + Intronic
1113995030 14:16057760-16057782 GGCCTGCGGGGGGAGGGGGAAGG - Intergenic
1115544454 14:34453189-34453211 TGCCTGCAGGGTGAGGATGAGGG + Intronic
1117097557 14:52314120-52314142 CGCCGGCGGGGAGGGAGAGAAGG - Intergenic
1121950341 14:98166145-98166167 CGTCTGTGAGGTGAGAGTGCGGG + Intergenic
1122262604 14:100531781-100531803 AGCCTGCTGGGTGGGGGTGATGG - Intergenic
1122604264 14:102937972-102937994 CACTTGCGGTGTGAGGGTGACGG - Intronic
1122635133 14:103126290-103126312 CTCCTGCGGGGTGGGGGTGAAGG - Exonic
1124459286 15:29874261-29874283 CGCCTGCAGGGTGACAGTAAAGG + Intronic
1126100061 15:45113423-45113445 AGCCTGCGGGGTGAGGGTGGGGG + Exonic
1127385077 15:58460535-58460557 CCCTTACAGGGTGAGAGTGAGGG - Intronic
1129313015 15:74725522-74725544 CACCTTCAGGGTGAGGGTGAAGG + Exonic
1131180242 15:90234153-90234175 CGCCTCCGGGGTGGGAGGGGGGG + Intronic
1131199990 15:90388200-90388222 GGCCTGCGGGGTGGGGCTGACGG + Exonic
1132895913 16:2229327-2229349 GGCCAGAGGTGTGAGAGTGACGG + Intronic
1133350885 16:5099202-5099224 CTCCTGCGGGGTGGGATTGGGGG + Intergenic
1136913804 16:34163253-34163275 GGCCTGCGGGGGGAGGGAGAAGG - Intergenic
1137565287 16:49528887-49528909 CGCCTGCGGGGTGAGAGTGATGG - Intronic
1138379290 16:56589305-56589327 CGGATGCGGGGTGGGAGTGGGGG + Intronic
1139691675 16:68645610-68645632 CGCCCGAGGGCAGAGAGTGAAGG - Intronic
1140274517 16:73496796-73496818 AGTCTGGGGGGTGGGAGTGAGGG + Intergenic
1141033184 16:80607184-80607206 TGCTCGCGGGGTGAGGGTGACGG - Intronic
1142020784 16:87780899-87780921 AGCCTGTGGGGAGAGGGTGAAGG - Intergenic
1142197374 16:88745069-88745091 GACCTGCAGGGGGAGAGTGACGG - Intronic
1142202105 16:88766085-88766107 CGCCTGCGGGTGGGGTGTGAGGG + Intronic
1142275456 16:89116413-89116435 GGCCTGCAAGGTGAGTGTGAGGG + Intronic
1142968657 17:3596659-3596681 CACCTGGGAGGTGAGAGTGGAGG - Intronic
1142976180 17:3645971-3645993 GGCCTGGGGGGTCTGAGTGACGG + Intronic
1143084378 17:4405104-4405126 CTCCTCCGGGGAGTGAGTGAGGG - Intergenic
1143304456 17:5934865-5934887 GGCCTGTGAGGTGAGTGTGAAGG + Intronic
1146940224 17:36839335-36839357 CTCCTGAGGGGTCACAGTGAGGG - Intergenic
1147120552 17:38332943-38332965 CCCCTGCTGAGTGAGAGTGGAGG + Intronic
1147496905 17:40925354-40925376 CTCCTGGAGGGAGAGAGTGAAGG - Exonic
1148502384 17:48101468-48101490 CGCCTGCGCGGTGCGAGCGGCGG - Intronic
1148901948 17:50884995-50885017 CCCCTGCTGGGTGAGTGTGGTGG - Intergenic
1156411115 18:36829004-36829026 CCCCTGCGGGGCGAGAGGGTGGG - Intronic
1156490596 18:37493646-37493668 AGCCTGCAGGGTGGGGGTGATGG + Intronic
1160187373 18:76686120-76686142 CACCTGCGGGGGCAGAGGGAAGG - Intergenic
1160823383 19:1068297-1068319 CCCCTGTGGGGTCAGGGTGATGG + Intronic
1161073268 19:2272873-2272895 TGCCTGCGGGCTGAGAATGAAGG - Intronic
1161153221 19:2720415-2720437 CGCCTGGGGGGTGCGGGTGGAGG + Intronic
1163155724 19:15439035-15439057 CGCCTGCGGGATGAGGCTGGGGG + Intronic
1163521950 19:17796686-17796708 CACCCTAGGGGTGAGAGTGAGGG - Intronic
1165145025 19:33725275-33725297 CCCCTGGGGGGTGAGTGTGTGGG - Intronic
1165745650 19:38228569-38228591 CGCCTGCGGGGAGGGAGGGCGGG + Intronic
1165854235 19:38870258-38870280 GGCCTGCGGGGTGTGGGGGACGG + Exonic
1167571405 19:50291136-50291158 TGCCTGTGGGTTGAGAGCGAGGG - Intronic
925926065 2:8671506-8671528 GGCCTGGGGGGTGAGGCTGAGGG - Intergenic
928171813 2:29009276-29009298 AGCCTGCGGGGTGGGGGTGAAGG + Intronic
932657722 2:73624813-73624835 CGCCTGCAGGGGGAGACTCAAGG + Intergenic
932664398 2:73685097-73685119 CGCCTGCAGGGGGAGACTCAAGG + Intergenic
933422149 2:82062240-82062262 CACCTGCAGGTTGGGAGTGAGGG + Intergenic
934125898 2:88889764-88889786 GGCCTGCGGGGGGAGAGCGGGGG - Intergenic
934557743 2:95296403-95296425 CTCCTGGGGTGTGAGGGTGAAGG - Intergenic
937956298 2:127423389-127423411 CACCTGCGGGGTGACACTGCAGG - Exonic
938583382 2:132668339-132668361 GGGCTGTGGGGTGGGAGTGAGGG - Intronic
940005094 2:149003074-149003096 CGTGTGGGTGGTGAGAGTGAGGG - Intronic
947098773 2:226596006-226596028 TGCTTGAAGGGTGAGAGTGAGGG - Intergenic
947643698 2:231722268-231722290 GGACTGCGGGGTGAGACTAAGGG + Intergenic
948129936 2:235592785-235592807 CCCTTGCAGGGTGAGAGTGCGGG + Intronic
948994174 2:241570379-241570401 CGCCTGGGGGGTGGGAGAGCTGG + Intronic
948994195 2:241570455-241570477 CGCCTGGGGGGTGGGAGAGCTGG + Intronic
948994218 2:241570531-241570553 CGCCTGGGGGGTGGGAGAGCTGG + Intronic
948994260 2:241570684-241570706 CGCCTGGGGGGTGGGAGAGCTGG + Intronic
948994302 2:241570837-241570859 CGCCTGGGGGGTGGGAGAGCTGG + Intronic
1170889218 20:20364790-20364812 CCTCTGCGGGGTGAGAATGCGGG + Intergenic
1171908715 20:30921826-30921848 GGCCTGCGGGGGGAGGGAGAAGG - Intergenic
1172102008 20:32490343-32490365 GGACTGGGGGGTGAGAGGGAAGG + Intronic
1172169193 20:32918604-32918626 CGCCGGCGGCTAGAGAGTGAGGG - Intronic
1174448909 20:50608235-50608257 TGACTGAGGGGTGGGAGTGAGGG + Intronic
1174859942 20:54081638-54081660 GGCCAGCGGGGAGGGAGTGACGG - Intergenic
1177225961 21:18256601-18256623 CGCCTGGCTTGTGAGAGTGAGGG + Exonic
1179608180 21:42531881-42531903 GGTCTGCGGGGTGCGGGTGAAGG + Intronic
1179959499 21:44760075-44760097 CTGCTGCAGGGAGAGAGTGAGGG - Intergenic
1179994693 21:44968456-44968478 CCCCTGCGAGGTGACAGGGAGGG - Intronic
1180312062 22:11249649-11249671 GGCCTGCGGGGGGAGGGGGAAGG + Intergenic
1180738258 22:18034894-18034916 AGCTTGTGGGGTGAGAGTGAAGG + Intergenic
1181646374 22:24233457-24233479 GGCCTGGGGGGTGGGAGTGGGGG + Intronic
1181688219 22:24543594-24543616 GGCCTGTGGTGTGAGAGGGAGGG + Intronic
1184947465 22:47813701-47813723 TGGCTGCGGGGTGAGGGTGGTGG + Intergenic
954800215 3:53182981-53183003 CCTCTGCGGGGTGAGGGTGTGGG + Intronic
961365905 3:126399047-126399069 CTCCTGTGGGGTGTGAGGGAGGG - Intronic
961540089 3:127593500-127593522 GGTCTATGGGGTGAGAGTGATGG + Intronic
961888814 3:130112936-130112958 CTCCTGCGGGGTGGGATTGGGGG + Intronic
967316266 3:188154276-188154298 CGCCCGCGGGTGGAGGGTGAGGG - Intronic
969240426 4:5893287-5893309 CGCCTGGGGGCGGAGAGTGGGGG - Intergenic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
969591837 4:8126504-8126526 GGCCTGTGGGGTGAAGGTGATGG - Intronic
969645837 4:8428338-8428360 CGCCTGCTGGGTGAGTTGGACGG - Intronic
969756040 4:9151800-9151822 CTCCTGCGGGGTGGGATTGGGGG - Intergenic
969842149 4:9890607-9890629 CACCTGCAGGGTCAGCGTGATGG + Exonic
975460659 4:74649826-74649848 TTCCTGCAGGGTGAGAGTCATGG - Intergenic
978954827 4:114599703-114599725 CGCCTGCGGGCGGGGAGAGAAGG + Intronic
979524052 4:121698570-121698592 CGCCAGTGGGGTGGGGGTGATGG - Intergenic
981034413 4:140154273-140154295 CTCCTGCCGGGTGAGAGTCCGGG - Intergenic
981227079 4:142309809-142309831 CTCCAGCTAGGTGAGAGTGATGG - Intronic
992507216 5:77398737-77398759 TGCCAGCGGGTTTAGAGTGACGG - Intronic
995840693 5:116440658-116440680 CCCCGGGGGGGTTAGAGTGAGGG + Intergenic
997804167 5:136898260-136898282 CTGTTGCGGGGTGGGAGTGAGGG - Intergenic
1002828941 6:801047-801069 CGCCCGGGTGGTGAGAGTTAGGG + Intergenic
1003499072 6:6689486-6689508 GTTCTGTGGGGTGAGAGTGAAGG - Intergenic
1004302928 6:14474911-14474933 AGCCTGGGGGCTAAGAGTGAAGG - Intergenic
1005837897 6:29721632-29721654 GGCCTGAGGGATGAGAGGGACGG + Intergenic
1005851496 6:29826581-29826603 GGCCTGAGGGATGAGAGGGACGG + Intergenic
1006022755 6:31126975-31126997 GTCCTGCGGAGTGAGTGTGAGGG + Intronic
1006473919 6:34243341-34243363 GGCCTGTTGGGTGAGAGTGTTGG + Intronic
1011597595 6:89031044-89031066 TGTCTGAGGGGTGGGAGTGATGG + Intergenic
1011751618 6:90460276-90460298 GGACTGCGGGGTGAGGGTGGGGG + Intergenic
1015919560 6:138253460-138253482 CTCCTGAGAGGTGAGAGAGAAGG + Intronic
1018749931 6:166795648-166795670 GGACTGCGGGGTGAGAAAGACGG + Intronic
1019473651 7:1233814-1233836 CGCCTGCTGGGGAAGAGTGGAGG + Intronic
1020558037 7:9693770-9693792 CACTTGTGGGCTGAGAGTGATGG - Intergenic
1024505684 7:50159312-50159334 CGCCTGCCGGGGGAGAGAGGCGG - Exonic
1024520857 7:50303759-50303781 CGCCAGCGGGGCGAGCGTGAGGG + Intergenic
1028087852 7:86658382-86658404 GGCCTGGGGAGTGAGAGGGAAGG - Intronic
1032013299 7:128360529-128360551 CCCCTGGGGTCTGAGAGTGAGGG - Intronic
1036379289 8:8227105-8227127 CTCCTGCGGGGTGGGATTGGGGG - Intergenic
1036850271 8:12195508-12195530 CTCCTGCGGGGTGGGATTGGGGG + Intergenic
1036871633 8:12437781-12437803 CTCCTGCGGGGTGGGATTGGGGG + Intergenic
1041102703 8:54412557-54412579 TGCCTGGGGGCTGAGAGAGAAGG - Intergenic
1042485185 8:69339775-69339797 GGCCAGAGAGGTGAGAGTGAGGG + Intergenic
1048767736 8:137862908-137862930 CACCTGCGGGGGGAGAGGGAAGG - Intergenic
1056215000 9:84398221-84398243 CCCATGCGGAGTGAGGGTGAGGG + Intergenic
1057309576 9:93933616-93933638 GGAGTGGGGGGTGAGAGTGAAGG + Intergenic
1057757145 9:97847814-97847836 AGCCTGCGGGCTGGAAGTGAGGG - Intergenic
1060047638 9:120353462-120353484 GGCCTGCGGGGGGACAGGGAGGG + Intergenic
1062012681 9:134275495-134275517 CCCCTGCGGGGAGGGAGGGATGG - Intergenic
1062213073 9:135374993-135375015 CGCCTCCGGGGTGGGAGGGTGGG + Intergenic
1062544609 9:137055828-137055850 CGCCTGCGGAGGGAGAGGCAGGG + Intergenic
1188641855 X:32515196-32515218 AGCCTGCCGAGTGAGAGTGTGGG + Intronic
1200098026 X:153673299-153673321 CGCCTTCGGGGTGCGGGGGAGGG - Intronic
1200104040 X:153702598-153702620 TGCCTGGGGGCTGAGAATGAGGG - Intronic
1200175126 X:154108781-154108803 CCCCTGCAGGGTGAGGGAGAGGG + Intergenic