ID: 1137567102

View in Genome Browser
Species Human (GRCh38)
Location 16:49540088-49540110
Sequence CTTGGTCATGTCCAGTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137567102_1137567110 26 Left 1137567102 16:49540088-49540110 CCTTCCTACTGGACATGACCAAG 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1137567110 16:49540137-49540159 TAGAATGCTGGCCTCAGCTGGGG 0: 1
1: 0
2: 3
3: 17
4: 200
1137567102_1137567109 25 Left 1137567102 16:49540088-49540110 CCTTCCTACTGGACATGACCAAG 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1137567109 16:49540136-49540158 CTAGAATGCTGGCCTCAGCTGGG 0: 1
1: 0
2: 7
3: 45
4: 243
1137567102_1137567108 24 Left 1137567102 16:49540088-49540110 CCTTCCTACTGGACATGACCAAG 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1137567108 16:49540135-49540157 TCTAGAATGCTGGCCTCAGCTGG 0: 1
1: 0
2: 2
3: 20
4: 199
1137567102_1137567106 14 Left 1137567102 16:49540088-49540110 CCTTCCTACTGGACATGACCAAG 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1137567106 16:49540125-49540147 ATGCACAGCCTCTAGAATGCTGG 0: 1
1: 0
2: 1
3: 13
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137567102 Original CRISPR CTTGGTCATGTCCAGTAGGA AGG (reversed) Intronic
901140218 1:7024253-7024275 CATGTTCATTTTCAGTAGGAAGG - Intronic
903312493 1:22470585-22470607 TATGGTCAGGGCCAGTAGGAGGG + Intronic
904181539 1:28669351-28669373 CTGGGTCCTGCCCAGTGGGAGGG + Intronic
904198092 1:28801043-28801065 CAAGGTCATGTCCAGTATGGAGG + Intergenic
906702066 1:47866775-47866797 CTTGGACAGGCCCAGTGGGATGG - Intronic
907454379 1:54565762-54565784 CTGGGACAGATCCAGTAGGAGGG - Intronic
910700435 1:90068471-90068493 GGTGGTCATGTCCCCTAGGATGG + Intergenic
913235844 1:116782450-116782472 CTAGGTCATGACCAGGAGAATGG + Intergenic
914455990 1:147836952-147836974 CTTGGGCATGTCCAGGTGAATGG - Intergenic
915304566 1:154970188-154970210 CTTGTTCATGTCCTGGAGGAGGG + Exonic
922566703 1:226605879-226605901 CTTGGTCCTGCACATTAGGATGG - Exonic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
923248718 1:232159897-232159919 CATGGTCAAGTCAAATAGGAGGG + Intergenic
1071979928 10:90994495-90994517 TATGGTAATGTCCAGCAGGAGGG - Intergenic
1072412279 10:95214309-95214331 TTTGGTGATGTCCAGTGGAAGGG - Intronic
1073913929 10:108379759-108379781 CATGGTCATATCCAGTGGAAAGG + Intergenic
1075490194 10:122860074-122860096 CTTTGTGATGTACAGTAGTATGG + Intronic
1076351257 10:129816429-129816451 CCTGGTCCTGTCCAGTGGGGCGG - Intergenic
1076871146 10:133195757-133195779 CCTGGCCATGTCCAGGAGGAGGG - Exonic
1078877818 11:15415662-15415684 CTTGGTCAGATGCAGTAGCATGG - Intergenic
1082238205 11:49845617-49845639 CTGGGACATGTGCAGTAGCACGG + Intergenic
1091131914 11:133153571-133153593 CTTGGATATTTCCAGTAGGTTGG - Intronic
1092149030 12:6234263-6234285 CCTTGTCATGTTCAGCAGGAAGG + Intronic
1094856448 12:34405024-34405046 CTTGTGCATGTGCAGTGGGAAGG - Intergenic
1095141274 12:38665952-38665974 ATTGGTACAGTCCAGTAGGAAGG - Intronic
1097145009 12:56934016-56934038 CTTGGTGACATCCAGTAGGGTGG + Exonic
1099435911 12:82644706-82644728 CCTGGTGATGTGCAGCAGGAAGG - Intergenic
1100246253 12:92760162-92760184 CTTGGTCATATTCAGCAGCAAGG + Intronic
1101345859 12:103885522-103885544 CATGGTGATTTCCAGAAGGAGGG + Intergenic
1101441974 12:104710516-104710538 CTTGGGCCTGTCCAGGAGGAGGG - Intronic
1102987523 12:117290569-117290591 CTTGTACATGTCAAGCAGGAAGG - Intronic
1104433765 12:128739315-128739337 GTATGTCATGTCCAGTTGGAAGG + Intergenic
1115889090 14:38007015-38007037 TTTGTTCATGTCCTTTAGGATGG - Intronic
1119516847 14:75254928-75254950 ATTAGTCAAGTCCAGTAGGTGGG - Intronic
1121390642 14:93570538-93570560 CTGGGCCATGTGCAGGAGGAAGG + Intronic
1202909079 14_GL000194v1_random:100643-100665 CTTGGTCAGGGCCTGAAGGACGG + Intergenic
1126937632 15:53728924-53728946 CTTGACCATGTGCAGTGGGATGG - Intronic
1131688817 15:94804120-94804142 CATGGTAATGTGCAGTAAGAGGG - Intergenic
1131825581 15:96320927-96320949 CTTGGTCTTGGCCAGAACGAAGG - Intergenic
1137567102 16:49540088-49540110 CTTGGTCATGTCCAGTAGGAAGG - Intronic
1138152839 16:54674866-54674888 CCTGGCCATGTCCAGCTGGAAGG - Intergenic
1138605165 16:58083909-58083931 CCTGGGCAGGTCCAGTAGCATGG + Intergenic
1142733537 17:1879752-1879774 CGTGGTCTTGTCCTATAGGATGG + Intronic
1142785331 17:2217622-2217644 CTAGGTGATGTGCAGGAGGATGG - Intronic
1143609920 17:8012328-8012350 CTTGATAAGGTCCAGCAGGAGGG - Exonic
1143630576 17:8137538-8137560 CTTGGTCATTTCCAGTTTCATGG - Intergenic
1147337090 17:39733320-39733342 CCATGTCATGTCCACTAGGATGG - Intergenic
1148465898 17:47865224-47865246 CTTGCTCTTGTGCAGGAGGAGGG + Intergenic
1149263038 17:54900161-54900183 TGTGGTCATGTCTAGGAGGAAGG - Intronic
1150360395 17:64527809-64527831 CTCAGTCATGTCCAGCAGTAGGG - Intronic
1150980321 17:70134142-70134164 CTTGGTCATGTCCTCGAAGAAGG - Exonic
1151690240 17:75679585-75679607 CTTGGTCCTGTCCTTTAGGTTGG + Intronic
1151891370 17:76952581-76952603 CATGATCTTGTCCAGCAGGAGGG + Intergenic
1158614016 18:58969315-58969337 CATGTTAATGTCCAGTTGGAAGG + Intronic
1159047901 18:63386735-63386757 GTTTGTCATTTTCAGTAGGATGG + Intergenic
1161108141 19:2454798-2454820 ATTGGGCATGGCCAGTGGGAGGG + Intronic
1163136395 19:15314529-15314551 ATTGGGCATCTCCAGGAGGATGG - Intronic
1164564269 19:29314791-29314813 CTTGGTCATTGGCAGGAGGAGGG - Intergenic
1167000792 19:46745164-46745186 GTTGGGCATGTCCAGTATGGAGG - Intronic
1202633349 1_KI270706v1_random:20084-20106 CTTGGTCAGGGCCTGAAGGACGG - Intergenic
1202652530 1_KI270707v1_random:20007-20029 CTTGGTCAGGGCCTGAAGGATGG + Intergenic
933479995 2:82844271-82844293 CTTTGTCATTTTCAGAAGGAAGG + Intergenic
934845387 2:97658809-97658831 CCTGGTCATGGCAAGCAGGACGG + Intronic
935040547 2:99422433-99422455 CTTGGTAATGTAGACTAGGAGGG + Intronic
935763794 2:106344699-106344721 GTTGGTCCTGTCCAGGAAGAAGG - Intergenic
940645139 2:156383864-156383886 CTGGGTCATGGCCAGTAGAATGG + Intergenic
947244282 2:228029861-228029883 CTTTGTCATGCCCAGGAGCAAGG - Intronic
1170678484 20:18503985-18504007 CTGGGTCATTTGCCGTAGGAGGG + Intergenic
1170824891 20:19784931-19784953 CTTGGTGATATCCAGAAAGAAGG + Intergenic
1172822777 20:37752828-37752850 TTTTGTCATGTCGAGTAGAAAGG - Intronic
1173700761 20:45069364-45069386 TTTTGTCTTGTCCAGCAGGATGG + Intronic
1176599621 21:8779647-8779669 CTTGGTCAGGGCCTGAAGGATGG - Intergenic
1176645563 21:9345947-9345969 CTTGGTCAGGGCCTGAAGGACGG - Intergenic
1176672023 21:9744307-9744329 GTTGGTCATGGACAGAAGGAAGG + Intergenic
1180367362 22:11953206-11953228 CTTGGTCAGGGCCTGAAGGACGG + Intergenic
1180378713 22:12118105-12118127 CTTGGTCAGGGCCTGAAGGACGG - Intergenic
1180418812 22:12795214-12795236 CTTGGTCAGGGCCTGAAGGACGG + Intergenic
1181541564 22:23575771-23575793 CTTGGACATGACCATGAGGAGGG - Intronic
1181551439 22:23641108-23641130 CTTGGACATGACCATGAGGAGGG - Intergenic
1181796821 22:25317534-25317556 CTTGGACATGACCATGAGGAGGG + Intergenic
1181850766 22:25748482-25748504 CTTGGTCATGTCCATTGACAGGG - Intronic
1184371351 22:44084129-44084151 CTGGGTCAAGGCCAGTGGGAAGG + Intronic
950105298 3:10384771-10384793 CTTGGCCCTGTCCTGTAGCATGG - Intronic
950124686 3:10504269-10504291 CTTTGACGTGTGCAGTAGGAGGG - Intronic
952825594 3:37521917-37521939 CTTGGACATTTCCTGTTGGATGG + Intronic
953213875 3:40899710-40899732 CTTGGGCATGGCCATAAGGATGG - Intergenic
954106764 3:48413769-48413791 CTGGGTCACGTGCAGTATGACGG - Exonic
958692419 3:97484789-97484811 TTTGGTCATTTACAGGAGGATGG - Intronic
966130467 3:176632515-176632537 GTTGATCTTGTACAGTAGGAAGG - Intergenic
1202741325 3_GL000221v1_random:59120-59142 CTTGGTCAGGGCCTGAAGGACGG + Intergenic
973213642 4:47644235-47644257 CTTGATCATGTCCAGCTGGAAGG - Intronic
973362977 4:49182063-49182085 CTTGGTCAGGGCCTGAAGGACGG - Intergenic
975856734 4:78632653-78632675 CTTGGTCATGGCCAGCACCAGGG + Intergenic
977435728 4:96991678-96991700 CTTGGGAATGTGCAGGAGGAGGG + Intergenic
978523838 4:109644079-109644101 CTTTGTCATGTTCAGTAGAGGGG + Intronic
980725913 4:136760505-136760527 CTTGGTCATGTCAATTGTGATGG + Intergenic
984908962 4:184653913-184653935 CTTGGTGTAGTCCAGCAGGAGGG - Intronic
985402712 4:189607541-189607563 GTTGGTCATGGACAGAAGGAAGG - Intergenic
1202760330 4_GL000008v2_random:103575-103597 CTTGGTCAGGGCCTGAAGGACGG - Intergenic
996389736 5:122946979-122947001 CTTGGTAAGGGCCAGTAGTATGG + Intronic
996389879 5:122948398-122948420 CTTGGTAAGGGCCAGTAGTATGG + Intronic
1003505294 6:6735529-6735551 CTTGGTGATGCCCATTAAGAAGG - Intergenic
1004009629 6:11669860-11669882 CTTAGTCATTCCAAGTAGGAGGG - Intergenic
1006377535 6:33679937-33679959 CTTCATCATGTCCAGCAGGTGGG - Exonic
1006535568 6:34696448-34696470 GTTGGTCATGTCCAGGAAGAAGG + Exonic
1013586355 6:111582355-111582377 CCTGGTCATGACAAGTAGTAGGG + Intronic
1013665127 6:112339966-112339988 GTTGGTCACTTCCCGTAGGACGG + Intergenic
1021530233 7:21635960-21635982 CTTGGTCATCTTCACTTGGATGG + Exonic
1023365366 7:39458262-39458284 CTTGGTAATGTCCAGTGGGCTGG - Intronic
1024971542 7:55075968-55075990 CTTGGACATTTCCAGTTGAATGG - Intronic
1029131035 7:98331113-98331135 CTTGGTCGTGTCCAGTCTGCTGG - Intronic
1029191050 7:98772599-98772621 TTTGGGCATGTTGAGTAGGAGGG - Intergenic
1031409563 7:121424880-121424902 CTTGGACATATCCAGCAGCAGGG + Intergenic
1049034295 8:140062290-140062312 TCTGATCATGCCCAGTAGGATGG - Intronic
1053532898 9:38899367-38899389 CTTGGTGCTGTTCAGAAGGAGGG - Intergenic
1056083380 9:83120517-83120539 CTTGCTCATGTCCATTTGGATGG - Intergenic
1057119752 9:92560414-92560436 TTGGGTCATGTCCAAAAGGATGG - Intronic
1058802301 9:108556564-108556586 CATGGTCATGTTCAGCAAGAAGG - Intergenic
1059310362 9:113384649-113384671 CATGGTCATGCCCAGTTGTAAGG - Intergenic
1059947790 9:119429551-119429573 CTTGGTCATCACCAGGAGGCAGG + Intergenic
1203482704 Un_GL000224v1:21311-21333 CTTGGTCAGGGCCTGAAGGACGG - Intergenic
1203709963 Un_KI270742v1:89046-89068 CTTGGTCAGGGCCTGAAGGACGG + Intergenic
1203541107 Un_KI270743v1:88468-88490 CTTGGTCAGGGCCTGAAGGACGG - Intergenic
1185699741 X:2221851-2221873 CTTGGTCATGGTCAGTGGGATGG + Intronic
1185883493 X:3761017-3761039 CTTGATCAAGCCCAGTAGGTTGG - Intergenic
1186335647 X:8583997-8584019 CTTGGTCACCTCCACTAGGCAGG + Intronic
1186520613 X:10203436-10203458 CTTGCACATGTTCTGTAGGAAGG + Intronic
1191740585 X:64432716-64432738 CTTGTTCATGTCCTGGAGGAGGG - Intergenic
1193398351 X:81012690-81012712 TTTTGTCATTTCCAGTGGGATGG + Intergenic
1195713860 X:107798605-107798627 CTTATTCATATCCAATAGGAAGG - Intergenic
1197875674 X:131102601-131102623 TTTAGTCATGTCAAGTGGGATGG + Intergenic
1201164936 Y:11200646-11200668 CTTGGTCAGGGCCTGAAGGACGG + Intergenic