ID: 1137568323

View in Genome Browser
Species Human (GRCh38)
Location 16:49548151-49548173
Sequence CTTGGAGGACCCACTGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137568323_1137568327 -8 Left 1137568323 16:49548151-49548173 CCTCACCCAGTGGGTCCTCCAAG 0: 1
1: 0
2: 1
3: 30
4: 224
Right 1137568327 16:49548166-49548188 CCTCCAAGCACCTCCCAGTTTGG 0: 1
1: 0
2: 2
3: 12
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137568323 Original CRISPR CTTGGAGGACCCACTGGGTG AGG (reversed) Intronic
900179061 1:1303452-1303474 CTTGGAGGCCCGTCTGGGAGGGG + Intronic
901508927 1:9704802-9704824 CTTGGGGGACCGGCTGGGCGTGG - Intronic
901667773 1:10836132-10836154 CTGGGAGGGGCCACTGGGAGCGG - Intergenic
901878959 1:12182791-12182813 CCTGGAGGAGCAACAGGGTGGGG + Intronic
904889279 1:33766251-33766273 CTGGGAGAAGCCACTGGGTTTGG - Intronic
906040752 1:42786130-42786152 CTTGGAGGCCACACTGGGCAGGG + Intronic
909683899 1:78324043-78324065 TTTGGAGGACAAACTGGATGAGG + Intronic
909691310 1:78410351-78410373 CTGGGAGGACCCACCCAGTGAGG - Intronic
909818635 1:80028980-80029002 CTTGGAGGACCATGTTGGTGAGG + Intergenic
909820111 1:80051093-80051115 CTTGGAGGACCCCCTGCAGGCGG - Intergenic
914196907 1:145452363-145452385 CTGGGAGTGCCCACTGGATGTGG + Intergenic
914197055 1:145452982-145453004 CTTGGGGCAGTCACTGGGTGAGG + Intergenic
915090289 1:153419458-153419480 CCTGGGTGACCCACTGGATGGGG - Exonic
915095204 1:153457633-153457655 CCTGGGTGACCCACTGGATGGGG + Intergenic
915687541 1:157649836-157649858 CACTAAGGACCCACTGGGTGAGG - Intergenic
917495197 1:175534183-175534205 CCTGGAGGACTCACAGGGTTGGG + Intronic
918293247 1:183130167-183130189 AGTGAAGGACCTACTGGGTGTGG + Intronic
919199742 1:194340676-194340698 ATGGGATGACCCACTGTGTGTGG + Intergenic
922460929 1:225813830-225813852 CTTGGAGAGCCTAATGGGTGTGG - Intronic
1063049007 10:2425256-2425278 CTTGGAAGACACACTTGGAGAGG - Intergenic
1064592129 10:16904948-16904970 GTTGGAGGACTCTCTGGCTGAGG + Intronic
1066075600 10:31872641-31872663 CATGGAGGATCAACTGGATGAGG - Intronic
1067804706 10:49384708-49384730 CTGGGAGCACCCCCAGGGTGTGG + Intronic
1068007752 10:51410091-51410113 CTAGGAGTACCCACTAGGAGTGG - Intronic
1068596159 10:58905138-58905160 CCTGGAGGACCCACTCAGTGAGG - Intergenic
1068811194 10:61257467-61257489 CTGGGAGGTCCCACTCAGTGAGG + Intergenic
1070857595 10:79619697-79619719 CTGGGAGGTCCCACTAAGTGAGG + Intergenic
1071440046 10:85681994-85682016 CTTGGAGTGTTCACTGGGTGGGG + Intronic
1072456247 10:95578930-95578952 CTGGGATGACAGACTGGGTGGGG + Intergenic
1074855962 10:117473656-117473678 CTTGGAGGAGCCAGTGGGGATGG + Intergenic
1075746903 10:124734414-124734436 CAAGGAGGACACAGTGGGTGAGG + Intronic
1075807633 10:125201568-125201590 CTGGGAAGACCCACAGGCTGGGG - Intergenic
1075986775 10:126794657-126794679 CTTGGAGGACTCAGTGGGTAGGG + Intergenic
1076144327 10:128105142-128105164 GTTGGGGTACCCACTGGGTCTGG + Exonic
1077295823 11:1825810-1825832 CGTGCAGGCCCCACTGTGTGCGG - Intergenic
1077326195 11:1965143-1965165 CTTGGAGACCCCACGGGGAGAGG + Intronic
1078792504 11:14558737-14558759 CTTAAAGGAGCCACTGGGAGGGG + Intronic
1079335152 11:19564564-19564586 TTTGGAGGAGCAACTGCGTGAGG + Intronic
1082791165 11:57347615-57347637 TTTGTAGCACCCACTGGGTGTGG - Intronic
1083429131 11:62604897-62604919 CTTGGAGGAGACACTGGGTTGGG + Intronic
1083655448 11:64227000-64227022 TCTGGCGGACCCACTGGGGGTGG + Exonic
1084647963 11:70471622-70471644 CTTTGAGGACCCAGTGGGTATGG - Intronic
1085303524 11:75472505-75472527 CTGGGAGGTCCCTCTGGCTGAGG + Intronic
1088728137 11:112657434-112657456 CTTGTGGGCCCCCCTGGGTGTGG - Intergenic
1088729807 11:112670893-112670915 CTGGGAGGACCCACCCAGTGAGG - Intergenic
1090520675 11:127475614-127475636 CTTGAAAGACCCACTGGCCGTGG + Intergenic
1092587906 12:9919623-9919645 CCTGGAGGACCCTCCTGGTGAGG + Intronic
1093240099 12:16659464-16659486 GTTGGAGGACAGGCTGGGTGCGG + Intergenic
1095964603 12:47858455-47858477 CTTGAAGGCCCCAAAGGGTGAGG + Intronic
1095967080 12:47875720-47875742 CCTGGAGGAAACACAGGGTGAGG + Intronic
1099167912 12:79329167-79329189 TCTGAAAGACCCACTGGGTGAGG + Intronic
1099388233 12:82045659-82045681 TTTGGAGGATGCACTGGGTTAGG - Intergenic
1101468931 12:104977062-104977084 CTTGGAGGACCGCCTGAGGGAGG - Intergenic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1106133829 13:26959900-26959922 CTCGGAGGACAGGCTGGGTGGGG + Intergenic
1106342378 13:28842842-28842864 CTAGGAGCACCCACTGTATGTGG - Intronic
1109361480 13:61299579-61299601 CTGGGAGGACCTGCTGGGTGAGG - Intergenic
1116223112 14:42113426-42113448 GGTGCAGGATCCACTGGGTGAGG - Intergenic
1116355624 14:43924939-43924961 CTAGGTGGACCAAGTGGGTGGGG + Intergenic
1116624330 14:47245479-47245501 CTTGAAGAACCCAGTGGGTAGGG - Intronic
1119407810 14:74409640-74409662 CTGGCAGGACCAGCTGGGTGGGG + Exonic
1122202227 14:100129585-100129607 CTTTGAGGTCCCACTGGGACTGG - Exonic
1123037492 14:105477407-105477429 CCTGGAGGACCCACGGGGACGGG + Intronic
1124623373 15:31293029-31293051 CTGGGAGGGCACAATGGGTGTGG - Intergenic
1124635034 15:31359973-31359995 CTGGGAGGAGCCACTGGGGCAGG - Intronic
1127262279 15:57335117-57335139 CTAGTGGGACACACTGGGTGAGG + Intergenic
1132941203 16:2509210-2509232 CTTTGAGGACCCAGTGGGGTGGG - Intronic
1133008828 16:2898937-2898959 CCTGGAGCATCCACTGGTTGGGG + Intronic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1136280523 16:29206345-29206367 CTTGGAGCTCACACAGGGTGGGG + Intergenic
1137231636 16:46572261-46572283 CCTGGAAGACCTACAGGGTGGGG + Intergenic
1137568323 16:49548151-49548173 CTTGGAGGACCCACTGGGTGAGG - Intronic
1142084891 16:88172304-88172326 CTTGGAGCTCACACAGGGTGGGG + Intergenic
1142198386 16:88749384-88749406 CTTGGAGGCCGCATCGGGTGGGG + Exonic
1145243080 17:21251032-21251054 CTTCCAGGCCCCACTGGGTTTGG - Intronic
1146157549 17:30536381-30536403 CTTGAAGGGCCCAAAGGGTGGGG - Intergenic
1148450851 17:47777143-47777165 CTATGAGGGCCCAGTGGGTGAGG - Intergenic
1148752184 17:49951723-49951745 CTTGGGGAACTCACTGGGCGGGG - Intergenic
1149705678 17:58692357-58692379 CGTGGAGAACCCACTGGGCCTGG + Intergenic
1150788357 17:68180280-68180302 CGTGCGAGACCCACTGGGTGAGG + Intergenic
1151401934 17:73861395-73861417 CTTTGGGGAACCAATGGGTGAGG + Intergenic
1151657186 17:75501591-75501613 CGTGGAGGAGGCACTGGGCGGGG + Exonic
1151821038 17:76497095-76497117 CTGGGGAGACCCACTGGGAGAGG + Intronic
1152616552 17:81340656-81340678 CTTAAAGGAGGCACTGGGTGAGG + Intergenic
1152641525 17:81451426-81451448 CTGGGAGGACCCACGGGGCAGGG - Intronic
1152644669 17:81463245-81463267 CAGGGAGGGCCCACGGGGTGGGG - Intronic
1153273194 18:3343316-3343338 CTTTGTGTAACCACTGGGTGAGG + Intergenic
1154502052 18:15001957-15001979 CGTGCAGCCCCCACTGGGTGCGG - Intergenic
1157495600 18:48154965-48154987 CTAGGAGGCAGCACTGGGTGAGG - Intronic
1157893222 18:51438673-51438695 GTTGGAGTAAACACTGGGTGAGG + Intergenic
1158040233 18:53084537-53084559 CCTGGAGGAGCAACTGGCTGAGG - Intronic
1160051967 18:75442184-75442206 CTTGGTGCACGCAGTGGGTGGGG + Intergenic
1160657187 19:279577-279599 TTTGGAGGACCCTCTGGGGATGG + Intergenic
1161108399 19:2455734-2455756 CTTGGGGGACCCCTTGGGAGGGG - Intronic
1163034971 19:14564896-14564918 AGGGGAGGACCCGCTGGGTGGGG - Intronic
1163533309 19:17863102-17863124 CTTGGTGGCCCCACAGGATGGGG + Intronic
1163575555 19:18109322-18109344 CTTGAAGGCCCCAGTGGTTGGGG + Intronic
1167242270 19:48351420-48351442 CTTGGGGAACCCACTGGGGATGG - Intronic
1167382482 19:49146551-49146573 CAAGGAGGACACACTGGCTGTGG + Intronic
1167791903 19:51688531-51688553 CTTTGAGCCCCCAGTGGGTGGGG + Intergenic
925321504 2:2973661-2973683 CTTGGAGGAGCCACAGGAGGAGG + Intergenic
928462178 2:31485272-31485294 CCTGGAGGACCTGCTTGGTGAGG + Intergenic
929615225 2:43301476-43301498 CATGGAGCTCCAACTGGGTGGGG + Intronic
930617380 2:53607703-53607725 GTTCCAGGGCCCACTGGGTGGGG - Intronic
931673390 2:64669672-64669694 CTTGGAGGCAACACTGAGTGTGG + Intronic
931716431 2:65032601-65032623 TTTGGAGGAGCTTCTGGGTGAGG + Intergenic
932689494 2:73900253-73900275 CTGGGAGGACCCAGTGGGGCGGG - Intronic
934758903 2:96842679-96842701 CCTGCAGCACCCACAGGGTGAGG - Intronic
938371028 2:130768435-130768457 CTGGGAGGACCCACTGGCCTCGG + Intergenic
938501230 2:131832129-131832151 CATGCAGCCCCCACTGGGTGTGG - Intergenic
938923178 2:136014239-136014261 CTTGGAGCACACACAGTGTGGGG + Intergenic
942942298 2:181632744-181632766 CCTGGAGGAGCCACAGGATGAGG - Intronic
943611916 2:190044628-190044650 CCTGGAGGACCTACCTGGTGAGG + Intronic
944601652 2:201309404-201309426 CATGGAGGACCCACTCAGTGAGG - Intronic
945209115 2:207364241-207364263 ATTTGAGGACCGACTGGATGGGG - Intergenic
945782827 2:214198256-214198278 CTTTGAGGACTCAGTGGGTGGGG - Intronic
945971748 2:216237795-216237817 CTTGAAGAACCCACTGTGGGAGG + Intergenic
946154848 2:217800673-217800695 CTTGGAGGACCCCGAGTGTGGGG + Exonic
946388490 2:219400915-219400937 CTTTGAGGGCCTCCTGGGTGTGG + Intergenic
947613133 2:231536181-231536203 TGTGGATGACCCACTGGGTGGGG - Intergenic
948029724 2:234807511-234807533 CTTGGAGGACCCAGATGATGAGG - Intergenic
948866189 2:240776000-240776022 CTTTGAGGACCCACTTGGCAGGG - Intronic
1170769924 20:19323633-19323655 CCTGGTGAACCCACTGGATGTGG - Intronic
1171504413 20:25622178-25622200 TGTGGAGGACACACTGGATGTGG + Intronic
1172429345 20:34876807-34876829 CGTGGAGGAGCCGCGGGGTGAGG + Exonic
1172749903 20:37243607-37243629 CCTGGAAGACAGACTGGGTGCGG + Intergenic
1172892751 20:38278482-38278504 CTTGGAGGACTCCCTGGGATGGG - Intronic
1173354047 20:42270333-42270355 CCTGGAGGACCCACTGAGTGTGG + Intronic
1174294981 20:49539539-49539561 CATGGGGGCCCCAGTGGGTGGGG - Intronic
1175130144 20:56782616-56782638 CCTGGAGGAGACACTGGGCGGGG - Intergenic
1175621696 20:60453048-60453070 CTGTGAGGTCCCACTGGCTGGGG - Intergenic
1178813373 21:35905059-35905081 CATGAAGGACCCACTGGGGTGGG + Intronic
1179025294 21:37674506-37674528 CTCGGCGGAGCCAGTGGGTGAGG - Intronic
1179656083 21:42845637-42845659 CTTGGAAGGCCCACAGTGTGTGG - Intronic
1181306991 22:21922685-21922707 CTTGAAGCACCCCCTGGGTCAGG - Exonic
1182162533 22:28137519-28137541 CTTGGAGGGCCCTCTTGGTTTGG + Intronic
1183069650 22:35387208-35387230 CTTGGAGGAACAACGGGGGGAGG - Intronic
1183457900 22:37932692-37932714 CTGGGAGGGCCTGCTGGGTGGGG + Intronic
1184092119 22:42298353-42298375 GTTGGGGCACCCATTGGGTGTGG + Intronic
1184520523 22:44991362-44991384 CCTGGAAAACCCACTGTGTGTGG + Intronic
950612165 3:14133632-14133654 CTTGCAGGAACCCCCGGGTGGGG + Intronic
951701203 3:25498277-25498299 CTTTGAGGACCCAGAGTGTGTGG - Intronic
952055104 3:29434761-29434783 CTGGGAGGAGCCATGGGGTGGGG - Exonic
952410734 3:33047694-33047716 CTTGGGTGACCTACTGGTTGTGG + Intronic
953255761 3:41288991-41289013 CTCGGAGCACACAGTGGGTGTGG + Intronic
953750902 3:45607656-45607678 CTTAGAGGACCTAGTGGGTAAGG + Intronic
954108628 3:48422276-48422298 CTGGGAGGGGCCTCTGGGTGGGG - Intronic
954286535 3:49623579-49623601 CCTTGAGGAACCACTGAGTGAGG - Intronic
954405124 3:50341200-50341222 CTTGGCCTACCCACTGGGTGGGG + Exonic
954430878 3:50470319-50470341 CCTGGAGGAGCCACTGGGGTGGG + Intronic
954746616 3:52791028-52791050 CTTGGAGGCCACACTGGAGGTGG - Intronic
957414207 3:79879336-79879358 CTAGGAGACACCACTGGGTGTGG - Intergenic
959973107 3:112428868-112428890 ATTCCAGGACACACTGGGTGGGG - Intergenic
965971657 3:174564411-174564433 CCTGGAGGACCTAGTGGGCGTGG + Intronic
967118336 3:186361725-186361747 CTTGGGGAACGCACAGGGTGGGG - Intronic
968622139 4:1608556-1608578 GTGGGAGGGCCCAGTGGGTGGGG + Intergenic
968812474 4:2806202-2806224 CTGGTGGGAGCCACTGGGTGGGG + Intronic
971003818 4:22351853-22351875 CTTGGAGGACCTGCCCGGTGAGG - Intronic
972990217 4:44814880-44814902 CTGGGAGGTCCCACTCAGTGAGG + Intergenic
975564341 4:75738221-75738243 CTTGGATGATCCACTGGCTTTGG - Intronic
976756001 4:88498388-88498410 CTTTCAGGACACACTGGGTTTGG - Intronic
986013189 5:3735260-3735282 CTGGGAGGACCTCCTGGGTGTGG - Intergenic
986175426 5:5348216-5348238 CTTGTAAGACCCTCTGGCTGCGG + Intergenic
988487925 5:31682177-31682199 CCTGGAGGACCCACGGGGAGGGG + Intronic
990759665 5:59114595-59114617 CTTGGAAGACACACAGAGTGAGG + Intronic
990940719 5:61200537-61200559 CAAGGAGGCCCCACTGGTTGAGG + Intergenic
992137232 5:73759131-73759153 CTAGCAGGACCCACTGAGGGTGG + Intronic
994144741 5:96382427-96382449 CAGGGAGGATCCACTGGGGGTGG - Intergenic
1001777127 5:174337346-174337368 CTTGGGGGCTCCACTGTGTGTGG + Intergenic
1002070459 5:176676409-176676431 TTTGCAGGAACCACTGGGAGGGG - Intergenic
1003391423 6:5716585-5716607 CCTGGAGGGCCCACAGGTTGAGG + Intronic
1007097093 6:39220101-39220123 CTTGTTGGCCACACTGGGTGGGG - Intronic
1010019056 6:71138969-71138991 CCTGGAGGACCCACCCAGTGAGG - Intergenic
1011514196 6:88134650-88134672 CTTGGAGGGCTCTCTGGGAGGGG + Intergenic
1011921061 6:92577651-92577673 CTGGGAAGACACACTGAGTGAGG - Intergenic
1012396608 6:98805153-98805175 CTTTGAGGACCCACGGGGAAAGG - Intergenic
1012565058 6:100638662-100638684 CTTGGAGCACCTACTGGATCGGG - Exonic
1018309353 6:162492285-162492307 CTTGGATGAGCCAAGGGGTGAGG - Intronic
1018995161 6:168704888-168704910 CTGGGAGGAGCCTCTGGGAGGGG - Intergenic
1019292797 7:258521-258543 CTGGGTGGACCCACTGCCTGGGG + Intronic
1019352889 7:563222-563244 CTCAGAGGACCCTCAGGGTGGGG - Intronic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1021792279 7:24217748-24217770 CCTGAAGATCCCACTGGGTGAGG + Intergenic
1024627794 7:51223152-51223174 CTGGCAGGGCCCACTGGCTGTGG + Intronic
1026766059 7:73160573-73160595 TTTGGAGGAGCATCTGGGTGTGG + Intergenic
1026875212 7:73875451-73875473 CTTGGAGGACCCACCCACTGTGG + Intergenic
1027042534 7:74970269-74970291 TTTGGAGGAGCATCTGGGTGTGG + Intronic
1027081109 7:75232088-75232110 TTTGGAGGAGCATCTGGGTGTGG - Intergenic
1031968393 7:128045273-128045295 CTGGGGGCAGCCACTGGGTGGGG - Intronic
1032584612 7:133134771-133134793 CTTGGATCCCCCACTGTGTGGGG + Intergenic
1032706511 7:134424742-134424764 CTTGGAAAAACCACTGGGTTAGG + Intergenic
1033839829 7:145360527-145360549 CGTGGGAGATCCACTGGGTGAGG - Intergenic
1034400244 7:150857256-150857278 CCTGGAGGACCCGCTGCCTGGGG + Exonic
1035231324 7:157467762-157467784 CTTGGAGGTCCCCCGGGGCGCGG - Intergenic
1035242773 7:157542972-157542994 CTTCGAGGACCCACAGGGCTTGG - Intronic
1035981839 8:4381286-4381308 GTTGGGGAAACCACTGGGTGGGG + Intronic
1037632946 8:20674817-20674839 CTTTGATAAACCACTGGGTGAGG + Intergenic
1037907877 8:22726091-22726113 GTTGGAGGTCCCACTCGGGGTGG + Intronic
1038490544 8:27967491-27967513 CATGTAGGAATCACTGGGTGGGG + Intronic
1040318378 8:46276760-46276782 TCTGGAGCACCCCCTGGGTGGGG - Intergenic
1042847759 8:73185419-73185441 CTTGGAGTACCAAGAGGGTGGGG + Intergenic
1044827850 8:96215278-96215300 CTTAGAGGACAGACTGGGTCTGG - Intergenic
1049241963 8:141542532-141542554 CATGGAAGGCCCAATGGGTGGGG + Intergenic
1049424593 8:142532448-142532470 CCTGGAGGACCTCCTGGGAGGGG + Intronic
1049530568 8:143152382-143152404 TTTGGAGGCCCCACTGGGGAAGG + Intergenic
1051159977 9:14196603-14196625 CTTGGAGGACACATTCTGTGGGG - Intronic
1052626456 9:30982060-30982082 CCTAGAGGACCAACTTGGTGAGG - Intergenic
1053312351 9:37027680-37027702 CTTTCAGGACCCGCTGCGTGTGG + Intronic
1056752637 9:89363350-89363372 CTTGAAAGATCCACTGGATGTGG + Intronic
1057147215 9:92766069-92766091 CTAGGAGAACCGAATGGGTGTGG - Intergenic
1057956399 9:99411712-99411734 CCTAGAGGAGCCTCTGGGTGTGG + Intergenic
1060481889 9:124021283-124021305 CCTGGAGGACCCGCTTGGTGAGG - Exonic
1062120401 9:134831040-134831062 CTTTGAGGACCACCTGGGAGTGG - Intronic
1062628424 9:137453268-137453290 CTTGGAGGACCCTCCGGGATGGG - Intronic
1062697679 9:137883860-137883882 CTTGGGGCAGTCACTGGGTGAGG - Intronic
1062697827 9:137884479-137884501 CTGGGAGTGCCCACTGGATGTGG - Intronic
1062707517 9:137953623-137953645 CTTGGAGGAGGCACCGGGGGAGG + Intronic
1185469999 X:376534-376556 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470015 X:376595-376617 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470091 X:376892-376914 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470107 X:376953-376975 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470123 X:377014-377036 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470199 X:377311-377333 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470288 X:377665-377687 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470335 X:377848-377870 CACGGCGGACCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1188906552 X:35798669-35798691 ATTGGCGGACACACTGAGTGAGG + Intronic
1189254087 X:39623958-39623980 CTTAGTGGAGCCACAGGGTGGGG - Intergenic
1190115786 X:47625623-47625645 CTTGGAGGATCCACAGGATCTGG + Intronic
1190358462 X:49627264-49627286 CTGGGAGGCACCACTGGGTAGGG + Intergenic
1190652890 X:52583572-52583594 CTTGGAAGTTCCAATGGGTGGGG + Intergenic
1191877371 X:65810118-65810140 CTGGGAGGACCCACCCAGTGAGG - Intergenic
1194608081 X:96006107-96006129 CTGGGAGGTCCCACTCAGTGAGG - Intergenic
1194867410 X:99086051-99086073 TTTGGAGGTCCCACTCAGTGAGG - Intergenic
1197623751 X:128780757-128780779 CTTGGAGGCCCCAGGGGGAGGGG - Intergenic
1199307201 X:146280167-146280189 TTTGGATGACCCACCTGGTGAGG + Intergenic
1199995514 X:153022617-153022639 CATGCATGACCCACTGGGTCTGG - Intergenic
1200205832 X:154315582-154315604 CTCAGAGGACCCACTGTCTGTGG - Intronic
1201304207 Y:12536906-12536928 CAAAGAGCACCCACTGGGTGAGG + Intergenic
1202042452 Y:20699396-20699418 CTTGGATGACACAGTGGCTGTGG + Intergenic