ID: 1137569619

View in Genome Browser
Species Human (GRCh38)
Location 16:49557143-49557165
Sequence GAGAGTGACCAGGGCGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137569619 Original CRISPR GAGAGTGACCAGGGCGTGCA GGG Intronic
900576685 1:3386064-3386086 GAGAGTGAGAAGGGCCTCCAGGG - Intronic
900924920 1:5699001-5699023 GAGAGGGACCATGCTGTGCAAGG - Intergenic
901204285 1:7485018-7485040 CAGAGTCACCAGGGCAGGCATGG - Intronic
901653834 1:10757938-10757960 CAGAGTGGCCAGGACGTGGATGG - Intronic
902105590 1:14033240-14033262 GAGAGAAACCAGGGTGGGCAAGG + Intergenic
903336690 1:22629141-22629163 GAGAGTGGCCAGGGAGAGCCTGG - Intergenic
904501493 1:30915317-30915339 GAGAGTGACCGGGGCCTGTGGGG + Intergenic
906208840 1:44001112-44001134 CAGAGTTGCCAGGACGTGCAGGG - Intronic
907336215 1:53701476-53701498 GAGAGTGCTCATGGCGTGCCAGG + Intronic
907944303 1:59119961-59119983 GACAGTGACCAGGGAGTTTATGG - Intergenic
915144831 1:153790317-153790339 GACAGTGTCCTGGGCGTGCTTGG + Intergenic
915549188 1:156622779-156622801 GAGAGTGACAAGGCCAGGCACGG + Intronic
916602447 1:166306284-166306306 GACAGTGAACAGGGAGGGCACGG + Intergenic
919931837 1:202226093-202226115 GAGAGTGACCACTGTGGGCAGGG - Intronic
919944106 1:202307380-202307402 CAGCTTGACCAGGGAGTGCAGGG - Exonic
921610901 1:217210969-217210991 GAGAGTGACTAGAGAGTGAATGG - Intergenic
1063968246 10:11363381-11363403 GAGCGTGACCAGGGAGAGCGCGG + Intergenic
1066058023 10:31699493-31699515 GGCAGGGACCAGGGCGTGGAGGG + Intergenic
1072250334 10:93577317-93577339 GAGAGTGAGCAGGCCCTACAGGG - Intronic
1076670501 10:132118298-132118320 GAGAATGTCCAGGGATTGCAAGG + Intronic
1076828099 10:132980542-132980564 GAGAGTGCCCAGCGAGTGCCCGG + Intergenic
1077154577 11:1085648-1085670 GAGGGTGGCCAGGGCAGGCAGGG - Intergenic
1077664153 11:4093116-4093138 GAGGGTGTCCAGGGAGTACAAGG - Exonic
1077846397 11:6029668-6029690 GGGAGTGACCAGGAGGTACAAGG - Intergenic
1081574394 11:44310170-44310192 GAGAGCGAGCAGGCCGGGCAAGG - Intergenic
1083764655 11:64836094-64836116 GTGAGTGACCAGGGTGGGTAGGG - Intronic
1084630616 11:70346185-70346207 CAGTGTGACCAGGGGGTGCCTGG + Intronic
1084694883 11:70747047-70747069 GAGACTGAGCAGGGAGTGCAGGG - Intronic
1088906994 11:114162576-114162598 GAGAGTGGGCAGAGGGTGCATGG - Intronic
1089678555 11:120106799-120106821 GAAGGTGATCAGAGCGTGCAGGG - Intergenic
1098284537 12:68894114-68894136 GAGAGTGACTAGGGTGTATATGG - Intronic
1100188226 12:92160698-92160720 GTGAGTGACCTGGGCCGGCACGG - Intergenic
1101327949 12:103733037-103733059 GAGAGTGACTGGGGTGTGGATGG - Exonic
1102111049 12:110366110-110366132 GGGAGTGGCCTGGGCCTGCAGGG + Intergenic
1102868172 12:116390987-116391009 GAGAGTGACCATGGTGCTCATGG - Intergenic
1103605400 12:122082175-122082197 GAGTGTGCCCAGGGCCTGCTGGG + Intronic
1103971250 12:124674185-124674207 GAGTGTGATCAGGGTGTCCAGGG - Intergenic
1105434214 13:20363019-20363041 TAGAGTGACCATGGCCTACAAGG - Intergenic
1105913704 13:24893955-24893977 GAGAGTGGCCAGGGCAGGTAAGG + Intronic
1108884519 13:55164100-55164122 GAGTTTGACCACAGCGTGCAAGG - Intergenic
1111898663 13:94173192-94173214 GAGAGTGACCAGGTCTGGCTGGG + Intronic
1113619087 13:111700978-111701000 GAGAAGGACAAGGGCATGCAGGG - Intergenic
1113624616 13:111786239-111786261 GAGAAGGACAAGGGCATGCAGGG - Intergenic
1115259663 14:31438315-31438337 GATAGTTACCAGGGCCTGGAGGG - Intronic
1119168490 14:72515150-72515172 GAGAGTCCCCAGTGTGTGCAGGG + Intronic
1122355551 14:101121033-101121055 GAGGGTCACCAGGAAGTGCACGG - Intergenic
1122661284 14:103297260-103297282 GGAAGGGGCCAGGGCGTGCAGGG - Intergenic
1126412943 15:48390697-48390719 GAGAGGGACGAGGGTGTGGATGG - Intergenic
1127648030 15:60976765-60976787 GTGAGTGAGCAGGGATTGCAGGG + Intronic
1127707636 15:61562809-61562831 GACAGTGCCCAGGGTTTGCATGG + Intergenic
1128920399 15:71605201-71605223 GACAGGGACCAGACCGTGCAGGG + Intronic
1130014097 15:80174128-80174150 GAAAATGACCAGGGTGGGCAGGG - Intronic
1132543168 16:520937-520959 GACAGTGCCCAGAGCATGCAGGG + Exonic
1132637474 16:959382-959404 GAGACAGACCCGGGCGTGCCAGG + Intronic
1132710747 16:1266023-1266045 GAGCGTGGCCAGGGCTTCCAGGG + Intergenic
1133513440 16:6483279-6483301 GAGAGCGAGCAGCCCGTGCAAGG - Intronic
1134105804 16:11485340-11485362 GAGAGTGACATGGGAGTTCAGGG - Intronic
1134202888 16:12213598-12213620 GAGAGTGTCCAGGCTGTGGAAGG + Intronic
1137446421 16:48535186-48535208 GATGGTGACCAGGGTTTGCAGGG + Intergenic
1137569619 16:49557143-49557165 GAGAGTGACCAGGGCGTGCAGGG + Intronic
1137635850 16:49985995-49986017 GATAATGACCAGGGCGGTCATGG + Intergenic
1138223236 16:55270842-55270864 GAGAGTGAGCCAGGCCTGCATGG + Intergenic
1139950235 16:70664879-70664901 GGGACTGACCTGGGCGTGAAGGG + Intronic
1140546961 16:75819965-75819987 AAGAGTGATCAGGGATTGCATGG - Intergenic
1146955225 17:36933355-36933377 AAGAGTGACAAGGCCGTGAAAGG - Intergenic
1148785867 17:50145954-50145976 GAGAGCGGCCTGGGTGTGCAGGG - Intronic
1149398704 17:56271632-56271654 GAGGGTGACCAGGAAGGGCAGGG + Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1154313915 18:13288773-13288795 CAGAGTGACCACGGTCTGCAGGG - Intronic
1155171109 18:23267417-23267439 GAGAGCCACCAGGGCTGGCACGG - Intronic
1155334775 18:24752427-24752449 GGGAGGGATCAGGGCGTGTAGGG + Intergenic
1155438166 18:25834254-25834276 CAGAGTTCCCAGGGCGTTCAGGG - Intergenic
1161156183 19:2732923-2732945 GAGAGCGCCCAGGGCGTGCCGGG - Exonic
1161422059 19:4181364-4181386 GAGACTGACTAGGGGTTGCATGG - Intronic
1162818802 19:13210724-13210746 GAGAGTGAGGAGGTGGTGCATGG + Intronic
1163130692 19:15271005-15271027 GAGAGTGGCCAGGACGTTCTTGG - Intronic
1164203554 19:23039200-23039222 GAGTGTGCCCAGGCCGAGCATGG - Intergenic
1165991565 19:39818147-39818169 GACAGTGACCAGGGCTGGGATGG - Intergenic
1166072111 19:40393841-40393863 GTGACTGACCAGGGCTGGCAGGG - Exonic
1166231502 19:41427698-41427720 TAGAGTGACCAGGGCGAGGCAGG + Intronic
1166500031 19:43333343-43333365 GACACTGACCAGGGTCTGCATGG + Intergenic
1166698833 19:44870200-44870222 GAGACTGAGGAGGGCGTGGATGG + Intronic
1167528289 19:49999348-49999370 GAGATTGCTCAGGGCCTGCATGG - Intronic
1168287047 19:55340290-55340312 GGGAGAGACCTGGGGGTGCAGGG - Intronic
1168327393 19:55545239-55545261 GAGAGAGACCAGGGTGGGCAGGG - Intronic
925179021 2:1804675-1804697 GAGAGTGACCAGCGCTGGCTGGG - Intronic
935378193 2:102421919-102421941 GAGAGTGAGGAGAGGGTGCATGG - Intronic
945219387 2:207468589-207468611 GAGAGTGCCCAGGGAGGGCATGG - Intergenic
946305289 2:218853461-218853483 GAGTGTGAACAGGGCGTGGAGGG + Intergenic
946732650 2:222724089-222724111 GGAATTGACCTGGGCGTGCAAGG + Intergenic
947131579 2:226932608-226932630 GAGAGGGACAAGGGAGTGGAAGG - Intronic
948465632 2:238150386-238150408 TAGACTGAGCAGGGGGTGCAGGG + Intronic
948836824 2:240629895-240629917 GAGAGTGAGCAGGGGGAGCAAGG - Intronic
1175196084 20:57244275-57244297 GAGAGTGTCCATGGAGTGCCTGG + Intronic
1175781734 20:61687093-61687115 GGGACTGGCCAGGGCGTGCGGGG - Intronic
1176138262 20:63534481-63534503 GAGCTTGGCCAGAGCGTGCAGGG - Intronic
1180174108 21:46079201-46079223 GGGCGTGACCAGGTCCTGCAGGG + Intergenic
1180213890 21:46312658-46312680 AAGACTGACCAGGCCGGGCATGG - Intronic
1180979932 22:19873682-19873704 GAGACGGCCCAGGGAGTGCAGGG - Intergenic
1180997802 22:19974089-19974111 GTGAGGGACCAGGTCGGGCAGGG - Intronic
1181393948 22:22604709-22604731 GAGAGTGAGGAGGGTGAGCAGGG - Intergenic
1181413093 22:22738733-22738755 GAGAGTGAAGAGGGTGAGCAGGG - Intronic
1181526832 22:23494448-23494470 CAGAGTGCGTAGGGCGTGCAGGG - Intergenic
1182861562 22:33563896-33563918 GGGAGTGACCAGGGCAAGCAAGG + Intronic
1182984882 22:34706895-34706917 GAGAGTGACCAAGTAGGGCAGGG - Intergenic
1184908580 22:47509686-47509708 AAGAGTCACCAGGGCGCACAAGG - Intergenic
950741702 3:15057294-15057316 GAGAGTGAGGAGGCCGGGCAGGG - Intronic
951829131 3:26904648-26904670 GAGAGGGACAAGGGAATGCAAGG + Intergenic
953199680 3:40767744-40767766 GAGAGTGAGTAGGGAGTCCAAGG - Intergenic
954132355 3:48567135-48567157 AAGGGTGACCAGGGCGAGAAAGG - Exonic
954805662 3:53218520-53218542 GAGAATGAGCAGGGAGAGCAGGG + Intergenic
955544809 3:60017144-60017166 CAGAGTGACTAGGGAATGCAGGG - Intronic
955854211 3:63255774-63255796 GAGTGTGAGCAGGAAGTGCAAGG + Intronic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
963603460 3:147396069-147396091 GTGCGTGACCAGCTCGTGCATGG + Exonic
964155225 3:153576964-153576986 GAGAGTGAAGAGGGAGTGAATGG - Intergenic
964977681 3:162639914-162639936 GAGAGTGAGCAAGGGCTGCAAGG - Intergenic
965977318 3:174641081-174641103 GAGATTGACCTGGGCGGGCCTGG + Intronic
969522395 4:7686284-7686306 AAGAGTGACCATGGACTGCACGG - Intronic
969640627 4:8396282-8396304 GAGTGTGCACAGGGCGTGCAAGG + Intronic
970446870 4:16130815-16130837 GAGAGTGAGCAAGGCCTGAAGGG + Intergenic
977470774 4:97438601-97438623 GAGAGTGAGCAAGGGCTGCAAGG + Intronic
981052145 4:140319845-140319867 GAGAAAGACAAGGGCCTGCAGGG + Intronic
981306753 4:143254659-143254681 GGGAGTGGCCAGGGCGTGCGAGG - Intergenic
985675087 5:1226818-1226840 AAGAGTCACCAGAGCATGCAAGG + Intronic
986185307 5:5430206-5430228 GAAAGTGAGCAGGGTGTGCCTGG - Intronic
987254157 5:16132098-16132120 GAGACTGACCAGATGGTGCAGGG + Intronic
988533341 5:32043915-32043937 GAGAGTGGTTAGGTCGTGCACGG - Intronic
990314452 5:54571062-54571084 GAAAGGGACCAAGGGGTGCAAGG - Intergenic
992746901 5:79829338-79829360 GAGAGAGAGAAGGGGGTGCAGGG - Intergenic
992985053 5:82220143-82220165 GGGAGTGAGCAGTGCGTGCAGGG + Intronic
995320032 5:110824034-110824056 GAGAGTGACTAGGGGGTGGGTGG - Intergenic
996478925 5:123951289-123951311 GCGAGTGAATAGGGTGTGCAAGG - Intergenic
997420107 5:133760085-133760107 GAGATTGTACAGGGCTTGCAAGG + Intergenic
999261125 5:150239583-150239605 GAGGGTGCTCAGGGCGTGCTTGG - Intronic
999635127 5:153613897-153613919 GGCAGGGTCCAGGGCGTGCAAGG - Intronic
1000345639 5:160311829-160311851 GAGAGTGACAAGGGCAGGGAGGG + Intronic
1001228719 5:169967535-169967557 AAGAGGGACCAGGTCATGCAGGG + Intronic
1003435405 6:6083442-6083464 GGGAGTGAGCAGGGAGTTCATGG + Intergenic
1004276058 6:14236090-14236112 GTGAGTGGCCAGGGTGAGCAGGG - Intergenic
1005688714 6:28281430-28281452 GAGAGTGACCTGGGCGGGGCAGG + Exonic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1009739206 6:67722893-67722915 GAGAGTGAGCAAGGGCTGCAAGG - Intergenic
1011129011 6:84034960-84034982 GAGAGTGACGAGGGCCTGCAAGG + Intronic
1018092017 6:160353873-160353895 GAGAGTCTCCAGGGTGTGCTTGG - Intronic
1019105227 6:169661684-169661706 GAGAGTAAGCAGGGTGGGCATGG - Intronic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1022729673 7:33010536-33010558 GAGAGGGAACAGGGTGTGGAAGG - Intergenic
1024354769 7:48403238-48403260 GACAGTGGCCAGGGAGTGAAGGG + Intronic
1025690476 7:63751292-63751314 GAGAGCGAGCTGGGCGTGGAGGG - Intergenic
1025690924 7:63753115-63753137 GAGAGCGAGCTGGGCGTGGAGGG - Intergenic
1027247170 7:76375066-76375088 GAGAGGGACCAGGAAGAGCAGGG + Intergenic
1032388157 7:131538683-131538705 GAGAGGAACCAGAGCGGGCAGGG - Intronic
1034386061 7:150742319-150742341 GTCAGTGACCAGGACGTGCCAGG + Exonic
1034948477 7:155280055-155280077 ATGAGTGACCAGGTCGTGGAGGG - Intergenic
1035027536 7:155835872-155835894 GAGGGTGACCTGGGCGTGGCTGG - Intergenic
1037539346 8:19856300-19856322 GAGAGTGCCCAGCGTGTGCCTGG - Intergenic
1037659148 8:20912243-20912265 GACAGGGGCCAGGGGGTGCAGGG - Intergenic
1037833725 8:22204134-22204156 GGGAGAGACATGGGCGTGCAAGG + Intronic
1043506420 8:80907626-80907648 GAGAAAGAACAGGGCGGGCAGGG - Intergenic
1049072273 8:140365349-140365371 GTGAGGGACCAGGGCAGGCAGGG - Intronic
1049601793 8:143511272-143511294 GAGAGTGAGCCGGGTGGGCAGGG - Intronic
1049963326 9:756835-756857 GAGAGAGCCCAGGGCAGGCAAGG + Intergenic
1053379363 9:37636227-37636249 GAGTGTGACCAGGGGATCCAGGG - Intronic
1061234361 9:129334049-129334071 GAGAGCAACCAAGACGTGCAGGG - Intergenic
1061259829 9:129474037-129474059 CAGAGTGCATAGGGCGTGCAGGG + Intergenic
1061490456 9:130941148-130941170 GGGAGTGACCCGGGCGTACCTGG + Intergenic
1061892380 9:133629613-133629635 GAGAGTCAGCAGAGCCTGCATGG + Intergenic
1062087998 9:134658488-134658510 GAAGGGGCCCAGGGCGTGCAAGG - Intronic
1062097263 9:134709876-134709898 GGGAGTGCCCAGGGCAGGCAGGG + Intronic
1186017764 X:5217681-5217703 GAGAGAGAGAAGGGAGTGCAGGG + Intergenic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1189181844 X:39011937-39011959 GAGAGGGACAACGGCCTGCAAGG + Intergenic
1192151434 X:68715124-68715146 GAGGGTGCCCAGGGAGTTCAGGG - Intronic
1192913628 X:75632120-75632142 AAGCGTGACCAGGGACTGCATGG + Intergenic
1195460335 X:105116225-105116247 GAGAGTGAGCAAGGGCTGCAAGG + Intronic
1195617636 X:106925714-106925736 GAGAATGATGAGGTCGTGCATGG + Intronic
1198507960 X:137319870-137319892 GACAGAGACCAGGGCCTGTAGGG - Intergenic
1200837334 Y:7745697-7745719 GTGAGTGTCCAAGGCTTGCAGGG - Intergenic