ID: 1137571378

View in Genome Browser
Species Human (GRCh38)
Location 16:49568446-49568468
Sequence CAGCTGGTCTAGGGAACAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137571378_1137571389 22 Left 1137571378 16:49568446-49568468 CCCCTTGTTCCCTAGACCAGCTG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1137571389 16:49568491-49568513 AACTCAAAAAACCTCTGACAAGG 0: 1
1: 0
2: 1
3: 15
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137571378 Original CRISPR CAGCTGGTCTAGGGAACAAG GGG (reversed) Intronic
900611092 1:3544955-3544977 CAGCTGGGGTAGGGAGCAAAGGG - Intronic
902251221 1:15155013-15155035 CAGCTTGTCTAGGGAACTGTTGG + Intronic
902376267 1:16031463-16031485 AAGCTGGTCTGGGGGACATGGGG + Intronic
902381229 1:16053392-16053414 GAGCTGGTCTGGGGGACACGGGG + Intronic
903050770 1:20599229-20599251 CAACAGGTCTAGAGAACAAAAGG + Intronic
903165846 1:21519897-21519919 CAGAAGGCCTAGGGAACAGGTGG - Intronic
904586495 1:31583851-31583873 CAGCTGGGTTAGGGCCCAAGGGG + Intronic
907217744 1:52880227-52880249 TAGCTGGTCTTGGGAAAAACAGG + Intronic
915168506 1:153962271-153962293 CAGCAGGTCCAGGAGACAAGTGG + Exonic
920987698 1:210906046-210906068 CAGCTGATGGAGGGGACAAGGGG + Intronic
922053695 1:222020015-222020037 CACCAGGACTAAGGAACAAGAGG + Intergenic
922129344 1:222761527-222761549 GAGCTGGACTAGGAAAGAAGAGG + Intergenic
924457371 1:244229463-244229485 CAGCTGGTAAAGGGCAGAAGTGG - Intergenic
1069616544 10:69810234-69810256 CAGCAGGTATTGGGAACAATTGG - Intronic
1071707250 10:88012450-88012472 CACCTGGGCTAGGGAACAAATGG + Intergenic
1074705137 10:116123500-116123522 CAGCTGGTTTAAGGAAAGAGTGG + Intronic
1074773208 10:116746497-116746519 CAGCTGGACCAGGGCTCAAGTGG + Intergenic
1075411652 10:122233007-122233029 AAGCTGCTCTAGGGAACAACCGG - Intronic
1076610537 10:131723343-131723365 CAGCTGCTCTTGTGACCAAGAGG - Intergenic
1080846025 11:36027723-36027745 CAGTTGTTCTTGGGCACAAGGGG + Intronic
1080872823 11:36251947-36251969 CAGCTAGTCTGGGGAAGAATGGG - Intergenic
1080925424 11:36751354-36751376 CAGCTGGGCTGGGGGCCAAGGGG - Intergenic
1081140544 11:39493657-39493679 CAGCAATTTTAGGGAACAAGGGG + Intergenic
1081237064 11:40659002-40659024 CAGCTGTGCCAGGGAACATGGGG - Intronic
1086989547 11:93287990-93288012 CAGTGGGTCTAGGGAACAGCTGG + Intergenic
1087798560 11:102479885-102479907 CAGCTGGATTAGGGACTAAGGGG - Intronic
1089093738 11:115900453-115900475 GGGCTGGTCTAGGGAAAGAGGGG + Intergenic
1089985664 11:122810495-122810517 CAGCTGCTCTAGAGAAAATGTGG - Exonic
1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG + Intergenic
1092769607 12:11884770-11884792 CACCTGGTCTCAGGAACAAATGG - Intronic
1092940979 12:13406719-13406741 CAGCTGGTCTTGAAAGCAAGTGG - Intergenic
1096146934 12:49284915-49284937 CAGCAGGACTAGGGAGAAAGAGG - Intergenic
1097195913 12:57242469-57242491 CAGCTGGGCTGGGGAAGAGGAGG - Intergenic
1098022558 12:66170810-66170832 CAGCTGGTGTAGGGGACAGGTGG + Intergenic
1101441607 12:104708401-104708423 CAGCTGGGCAGGGGCACAAGTGG - Intronic
1103136707 12:118513746-118513768 CAGCCGGGCCAGGGAGCAAGGGG + Intergenic
1103345620 12:120248197-120248219 CTGCTGGTCTGGGGAACATGAGG + Intronic
1105500898 13:20970889-20970911 CGGTGGGACTAGGGAACAAGGGG - Intergenic
1106431183 13:29682009-29682031 CAGCGTCTCTAGGGAAAAAGAGG - Intergenic
1106821750 13:33472568-33472590 TACCTGCTCTAGGGAACAACTGG - Intergenic
1109883018 13:68506817-68506839 CAGCTGGTACAGGGGAGAAGAGG + Intergenic
1110385473 13:74905939-74905961 CAGATGATTTAGGGAAGAAGTGG - Intergenic
1111633842 13:90877814-90877836 CAGTTATTCTTGGGAACAAGAGG - Intergenic
1113149266 13:107243399-107243421 CAGCTGTGCCAGGGAACAATGGG - Intronic
1116151379 14:41145817-41145839 CAGCAGGAGCAGGGAACAAGTGG - Intergenic
1119742748 14:77025364-77025386 GAGCTGGTCTAGGGCAAAGGAGG + Exonic
1120466828 14:84869233-84869255 CAGCTTATCTAGGCAGCAAGGGG - Intergenic
1122903248 14:104790602-104790624 CACCTGCTCTCGGCAACAAGAGG + Intronic
1123148542 14:106158308-106158330 GAGCTGGTTCAGGGAACAGGTGG - Intergenic
1124650779 15:31472279-31472301 CACATGGTCTGGGAAACAAGAGG + Intergenic
1126747125 15:51837453-51837475 CAGCTGGTCTAGCACTCAAGTGG - Intronic
1127827755 15:62719788-62719810 CAGCTGGTCCAGGGAGTGAGGGG + Exonic
1129324126 15:74790596-74790618 CCGCAGGGCTAGGGGACAAGGGG - Intronic
1131520783 15:93113008-93113030 CAGCTAGTGGAGGCAACAAGAGG - Intergenic
1135947121 16:26875043-26875065 CATCAGGTCTAGGGGACAATAGG - Intergenic
1136142714 16:28297796-28297818 GAGCTGGTCTAGGGAGGCAGAGG + Intronic
1137571378 16:49568446-49568468 CAGCTGGTCTAGGGAACAAGGGG - Intronic
1137861958 16:51855815-51855837 CACCTGTTCTAGATAACAAGTGG + Intergenic
1141292029 16:82727119-82727141 CAGGTGGTATAGGGAAGGAGTGG + Intronic
1142164725 16:88580038-88580060 CTGCTGGGCGTGGGAACAAGAGG - Intronic
1142596362 17:1031810-1031832 CGGCGGGACTAGGGAACTAGCGG - Intronic
1144012242 17:11160390-11160412 CAGGTGGTCTAAAGAACAATGGG + Intergenic
1144209514 17:13002753-13002775 CAGCTGAGCTAGGGAACACCGGG - Intronic
1144210916 17:13014812-13014834 CAACTTGTCTAGAGAAGAAGAGG + Intronic
1147728737 17:42583370-42583392 CTCCTTGTCTTGGGAACAAGGGG + Intronic
1151401816 17:73860650-73860672 CAGCTGGTCTTGGGCACATTGGG - Intergenic
1153934906 18:9913229-9913251 CACCTCGTCTAGGAAGCAAGGGG - Intergenic
1156218725 18:35029307-35029329 CAGCGTGTCAAGGGAACATGAGG - Intronic
1157684127 18:49629230-49629252 CAGCTACTCAAGGGAACAATTGG + Intergenic
1158518696 18:58152242-58152264 CAGCAAGGCTTGGGAACAAGAGG + Intronic
1160281422 18:77494295-77494317 CAGCTCCTCTAGGGAAGAAGGGG + Intergenic
1161253309 19:3293049-3293071 CAGCTGGTATAGGGGCCAGGTGG - Intronic
1162673440 19:12278479-12278501 GAGCTGGTCTCGGCACCAAGGGG + Intronic
1162923615 19:13918731-13918753 CAGCTGGTCTGGGGACAGAGAGG - Exonic
1167998372 19:53425250-53425272 CAGCAGCTCTGGGGAAAAAGTGG + Intronic
925939597 2:8804063-8804085 CAGTTGGTCAAGTGAACAAGTGG - Intronic
928437660 2:31266163-31266185 CAGCTGGTCCTGGGAAGAGGAGG - Exonic
929203720 2:39266202-39266224 CAGCTGGTTTAGAGCAAAAGAGG - Intronic
930108465 2:47658173-47658195 CAGCTCGTTAAGGGAACTAGTGG + Intergenic
930668505 2:54123574-54123596 CAGCTGGTAAAGGGAAGGAGGGG - Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
936492396 2:112983531-112983553 CAGCTGGCCTTGGGAAGATGTGG + Intronic
940165346 2:150764560-150764582 CAGCTTGTGTAGGGAGCATGAGG - Intergenic
941063176 2:160871232-160871254 CAGCTGTCCTAGGGAACATCTGG - Intergenic
942091449 2:172495486-172495508 CAGCTGGGATTGAGAACAAGGGG - Intronic
948650895 2:239443022-239443044 CTCCTGGGCAAGGGAACAAGCGG + Intergenic
1173271853 20:41543533-41543555 CATCTGATCTGGAGAACAAGTGG - Intronic
1173341232 20:42154707-42154729 CAGCAGGTTTAGGGAAGAAAAGG - Intronic
1176243304 20:64084895-64084917 CAGGGGGTGTAGGGACCAAGAGG - Intronic
1181305676 22:21916123-21916145 CACCTGGTCTTGAGAACAGGTGG - Intergenic
1182034697 22:27188693-27188715 CACCTGGAATATGGAACAAGGGG + Intergenic
1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG + Intronic
1183863367 22:40685029-40685051 CAGGTGGTCGAGGGGAGAAGTGG + Intergenic
1185404027 22:50635691-50635713 CAGCTGGGCTAGGGAGGACGGGG - Intergenic
1185404043 22:50635751-50635773 CAGCTGGGCTAGGGAGGACGGGG - Intergenic
950399429 3:12759202-12759224 CAGCTTGTCTGGGCAGCAAGGGG + Exonic
951279060 3:20725161-20725183 CAGCTGGTCTAATGGCCAAGTGG + Intergenic
954005520 3:47587465-47587487 CAGCAGGCCTAGGGAAGGAGCGG + Exonic
954432169 3:50476606-50476628 CACCTGGCCTTGGGAACAGGAGG - Intronic
954634321 3:52063386-52063408 GAGGTGGTCTAGGGGAGAAGGGG - Intergenic
963358517 3:144240258-144240280 CACCTTGTGGAGGGAACAAGAGG - Intergenic
966161828 3:176976631-176976653 CAACTGCTCTAGGGAACTGGTGG - Intergenic
967887871 3:194345627-194345649 CAGCTGGTCTCGGGACCCACAGG - Intronic
968439870 4:617813-617835 CACCTGGTCTAGGGAAGGACCGG + Intergenic
969220379 4:5755045-5755067 CAGCTGGACCAGGGACCTAGAGG - Intronic
969665879 4:8557429-8557451 CAGCGGGTCCTGTGAACAAGCGG + Intergenic
970382348 4:15520669-15520691 CATCTGGTCTTGGGTTCAAGTGG - Intronic
974515959 4:62911281-62911303 CAAAAGGTCTAGTGAACAAGAGG - Intergenic
977450013 4:97183523-97183545 AACCTGGTCTAGGGGCCAAGAGG + Intergenic
982409698 4:155060579-155060601 CAGCTTGTCTTTGGAACCAGAGG + Intergenic
984041056 4:174734354-174734376 CAGATGGTATAGGCAACATGGGG - Intronic
985198992 4:187464538-187464560 AAGTTGGTGAAGGGAACAAGAGG - Intergenic
989240185 5:39194618-39194640 CTGCTGGGATAGGAAACAAGAGG + Intronic
989588356 5:43090691-43090713 CAGCTGGACTAGGGAAAGTGAGG + Intronic
991074515 5:62519929-62519951 TGGCTGGACTTGGGAACAAGAGG - Intronic
992086202 5:73280579-73280601 CTGCTGGTTTAGACAACAAGTGG + Intergenic
997889867 5:137666227-137666249 GAGCAGGGCTGGGGAACAAGGGG + Intronic
997901390 5:137768540-137768562 CAGCTGGTCTGGGAAATAAAGGG - Intergenic
997957712 5:138293116-138293138 CAGCTGGTATCACGAACAAGAGG - Intronic
1002607072 5:180389847-180389869 CAGCAGGTCCAGGGGACAGGAGG - Intergenic
1003604282 6:7544782-7544804 CAGGTGGTCGGGGGAAAAAGAGG - Intronic
1005234694 6:23746400-23746422 CTGCTGGTCTAAGGAAGAAGAGG + Intergenic
1010204051 6:73307593-73307615 CTGCTGGCCTGGGGATCAAGAGG - Intronic
1010807860 6:80260137-80260159 CAGCTGGGCCAGGCAACTAGCGG - Intronic
1011781480 6:90794645-90794667 CAGCTGCTCTAGGGAGTAACTGG - Intergenic
1012146274 6:95686979-95687001 CAGCTGGTCCTGGGAACAGAAGG + Intergenic
1014726525 6:124978330-124978352 GATCTGGTCTGGGGCACAAGCGG - Intronic
1017937767 6:159021635-159021657 TTTCTGGTCTAGGGAACCAGGGG + Intergenic
1018715770 6:166531587-166531609 CAGCTGGTCTTCAAAACAAGGGG - Intronic
1018865467 6:167744058-167744080 GAGCTGGCCTGGGCAACAAGAGG - Intergenic
1019300481 7:300667-300689 CTGCTGGTCCTGGGGACAAGTGG - Intergenic
1023780666 7:43652112-43652134 CAGCCGGGCTTGGGAACCAGTGG + Intronic
1024414495 7:49088417-49088439 CAGCTGGCCTAGTGATAAAGAGG - Intergenic
1032555252 7:132826177-132826199 CAGATGCTCAAGAGAACAAGAGG + Intronic
1033222780 7:139539788-139539810 CAGCAGGTCTAGGTCACAGGGGG + Intronic
1036777021 8:11620618-11620640 CAGATGGTCCAGGAAGCAAGAGG - Intergenic
1037817130 8:22118241-22118263 CAGCTGGACTTGGGAACCACGGG + Intronic
1037888039 8:22605192-22605214 CAGCCGGTCGAGGAAACAACGGG + Intronic
1038743285 8:30234225-30234247 CAGTTGGTGTCGGGAAGAAGAGG - Intergenic
1039456325 8:37709894-37709916 CATCTGGCCAAGGGAACAACTGG + Intergenic
1039498658 8:38000135-38000157 CAGCTGGATTAGGGAACTGGCGG + Intergenic
1040641688 8:49341763-49341785 CAGCTGGTCTAGAGAAAACATGG - Intergenic
1043393003 8:79809356-79809378 CAGCTGGTCATGGGAATCAGCGG + Intergenic
1043398083 8:79857916-79857938 CAGCTGGTCTGGAGAACAGCCGG - Intergenic
1044847626 8:96397811-96397833 CAGTTGGTCTGGGGATCAAATGG - Intergenic
1045062928 8:98424392-98424414 CAGCTGGGGAAGGGGACAAGGGG + Intronic
1045115602 8:98976868-98976890 CAGCTGGTCTGGGGGAAATGAGG - Intergenic
1046709898 8:117499164-117499186 CAGCTGGCAGAGGAAACAAGCGG + Intergenic
1049196116 8:141316546-141316568 CATCTTGTCTAGGGTACAGGTGG + Intergenic
1049769932 8:144375056-144375078 CAGCTGGGCTGGGGCACGAGTGG - Intronic
1051395485 9:16615945-16615967 TAGCTGGTCAATGGAAAAAGTGG + Intronic
1052273897 9:26656736-26656758 CAGCTGGTGGAGGGGACAAAAGG - Intergenic
1052434648 9:28410439-28410461 CAGCTGGTTTAGGGGAGCAGGGG - Intronic
1053293301 9:36896263-36896285 CAGCTGGTCCAGGGGGCAACGGG + Intronic
1053410797 9:37914935-37914957 CAGCTCCTCTAGGAAACAGGTGG + Intronic
1054152680 9:61618039-61618061 CAGAGGGTCTAGGGAGAAAGTGG + Intergenic
1054180904 9:61908802-61908824 CAGAGGGTCTAGGGAGAAAGTGG - Intergenic
1054472459 9:65549187-65549209 CAGAGGGTCTAGGGAGAAAGTGG + Intergenic
1054656687 9:67672340-67672362 CAGAGGGTCTAGGGAGAAAGTGG + Intergenic
1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG + Intronic
1058804064 9:108573341-108573363 CAGAGTGGCTAGGGAACAAGGGG + Intergenic
1061035929 9:128114324-128114346 ACCCTGGTCCAGGGAACAAGGGG + Intergenic
1189862804 X:45290768-45290790 AAGCTGATCTAGGGAATTAGTGG - Intergenic
1192784834 X:74325546-74325568 CAGATGGTCTAGGGAATATCAGG + Intergenic
1200103715 X:153701087-153701109 CAGCTATTCAAGTGAACAAGGGG + Intronic
1200142412 X:153908683-153908705 TAGCTGGGCTAGGTAACAGGCGG - Intronic