ID: 1137571666

View in Genome Browser
Species Human (GRCh38)
Location 16:49570332-49570354
Sequence TCTTATCTGTAAAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1756
Summary {0: 2, 1: 27, 2: 125, 3: 450, 4: 1152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137571666_1137571672 -4 Left 1137571666 16:49570332-49570354 CCATCCCCATTTTACAGATAAGA 0: 2
1: 27
2: 125
3: 450
4: 1152
Right 1137571672 16:49570351-49570373 AAGAAGGCTGAGGCTCAGAGAGG 0: 1
1: 11
2: 144
3: 886
4: 3411
1137571666_1137571673 11 Left 1137571666 16:49570332-49570354 CCATCCCCATTTTACAGATAAGA 0: 2
1: 27
2: 125
3: 450
4: 1152
Right 1137571673 16:49570366-49570388 CAGAGAGGTTAATTGCACCATGG 0: 1
1: 0
2: 3
3: 20
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137571666 Original CRISPR TCTTATCTGTAAAATGGGGA TGG (reversed) Intronic
900845816 1:5099645-5099667 TGTCATCTTTAAAATGGGAAGGG + Intergenic
901234154 1:7658606-7658628 TCTTATCTGTAAAATGAGTCTGG + Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
901761705 1:11476233-11476255 TCTCATCTATAAAGTGGGGATGG - Intergenic
901764663 1:11492195-11492217 GGAAATCTGTAAAATGGGGATGG - Intronic
901776319 1:11562884-11562906 TCTCATCTGTAAAATGGGAGTGG + Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902096321 1:13948857-13948879 TCATGTCTGTAACATGGGAAGGG - Intergenic
902232985 1:15040076-15040098 TCCCACCTGTAAAATGGGGCTGG - Intronic
902236068 1:15058238-15058260 TGTTATGTGTAACATGGGGATGG - Intronic
902259903 1:15217011-15217033 TCTTATCTTTATAGTGGGAAGGG + Intronic
902263777 1:15247075-15247097 TCCTATCTGTGAAATGGGGCAGG + Intergenic
902283816 1:15393456-15393478 TGCTATCTGTAAAAGGGTGAGGG + Intronic
902306103 1:15540579-15540601 TCTTATAGGTAAAATAGAGATGG + Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902503194 1:16923975-16923997 ACTTATCTGTAATATGGGTGGGG - Intronic
902623468 1:17663748-17663770 CCCCATCTGTAAAATGGGGTGGG - Intronic
902657397 1:17878798-17878820 CCTCATCTGTAAAATAGGAAGGG - Intergenic
902689452 1:18101123-18101145 CCTCATCTGTAAAATGGGACTGG - Intergenic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902721267 1:18305839-18305861 TCCTTTCTGTAAAATGAGGACGG - Intronic
902812973 1:18899652-18899674 TTTAATCTGTGAAATGGGGGTGG + Intronic
902814970 1:18911186-18911208 CCTAATCTGTCAAATGGGGGTGG - Intronic
902893201 1:19460122-19460144 TTCTATCTGTAAAATTGTGAAGG + Intronic
903000900 1:20264992-20265014 TCTAACCTGTAAAGTGGGGATGG + Intergenic
903003603 1:20283847-20283869 TCTTATCTTTAGAGTGGAGATGG - Intergenic
903137726 1:21320286-21320308 TCTCATTTATAAAATGGGGATGG + Intronic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903177178 1:21588082-21588104 TCCTATCTGTAAAATGGGGCCGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903337727 1:22636146-22636168 TTTTATCTGTACACTGGGAACGG - Intergenic
903353386 1:22731473-22731495 CCTTATCTGTCAAATGGAGAGGG + Intronic
903475137 1:23614316-23614338 CCTTATCTGTAAAATGGGCGTGG - Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903542882 1:24106863-24106885 TCTCATCTGTAAAATTGGGCTGG - Intronic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903812413 1:26042091-26042113 CCCCATCTGTCAAATGGGGACGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903857795 1:26346844-26346866 TCTCATCTGTGAAATGGGCATGG + Intronic
903898083 1:26621627-26621649 CCCCATCTCTAAAATGGGGAAGG - Intergenic
903927613 1:26841821-26841843 CTTTATCTGTAAAATAGAGATGG - Intronic
904035194 1:27555296-27555318 CCTCATCTGTAAAATGGGAGGGG - Intronic
904040603 1:27582304-27582326 CCTTATCTATAAAATTGGGATGG + Intronic
904105793 1:28081669-28081691 TCTTATTTTGAAAAGGGGGAGGG + Intronic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904287768 1:29462972-29462994 TCTTACCTGTAAAGTGGGAGTGG + Intergenic
904316039 1:29664257-29664279 TCTCATCTGATAAATGGGGGTGG + Intergenic
904318934 1:29684035-29684057 CCCCATCTATAAAATGGGGATGG + Intergenic
904330455 1:29754997-29755019 TTTCTTCTGTAAAATGGGAATGG + Intergenic
904341038 1:29834787-29834809 CTTTATCTTTAAAATGGGGGAGG + Intergenic
904371095 1:30047799-30047821 TCTTATCTGTAAAGTGGGAGCGG + Intergenic
904407659 1:30303783-30303805 CCTTTTCTGTAAAATAGGGGTGG - Intergenic
904416221 1:30362598-30362620 TTTCTTCTGTAAAATGGGGATGG - Intergenic
904417292 1:30371168-30371190 TCCTATCTGTAAAGTGGGAGTGG - Intergenic
904428922 1:30449431-30449453 TCTTGTCTGTCAAATGGGCTTGG + Intergenic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904611084 1:31726742-31726764 TCACATCTGTGAAATGGGGATGG - Intergenic
904642863 1:31943804-31943826 CCTCATCTGTAATATGGGCATGG + Intronic
904882927 1:33714390-33714412 CCTTATCTGCAAAATAGGGATGG - Intronic
904890992 1:33779389-33779411 TGTCATCTGTAAAATGGAAATGG + Intronic
905032759 1:34898931-34898953 TCTCATCTTTAAAATGGCAATGG - Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905582060 1:39089826-39089848 CCTTATCTATAAAAGGGAGATGG + Intronic
905815911 1:40950687-40950709 TCTTATCTGTATATTGAGTATGG + Intergenic
905852368 1:41283558-41283580 CCTTATCTGTAAAGTGGGGTGGG + Intergenic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906124084 1:43415938-43415960 TCTTTTCTGTAACTTGGGGCAGG + Exonic
906591361 1:47027261-47027283 CCTGATCTGATAAATGGGGAGGG - Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906778206 1:48548796-48548818 TTTCATCTGCAAAATGGAGATGG - Intronic
906834075 1:49064045-49064067 TCTGATTTGTAAAATGGGAATGG + Intronic
906960335 1:50416089-50416111 CCTCCTCTGTAAAATGGGGCCGG + Intergenic
907044699 1:51293502-51293524 ACTGCTCTGTAAAATGGGAAAGG + Intronic
907046435 1:51302860-51302882 TCTCATCTGTGAAATGGGGGTGG - Intronic
907073384 1:51557727-51557749 TCTCATCAGTAAAATGGCAACGG + Intergenic
907257350 1:53190045-53190067 CCTTATCTGTAAAAGGGAGATGG - Intergenic
907263835 1:53242202-53242224 TCTCATCTATAAAATGGGAGTGG + Intergenic
907281814 1:53352460-53352482 TGTTATCTCTAAAATGGGACTGG - Intergenic
907331464 1:53674490-53674512 CCACATGTGTAAAATGGGGACGG + Intronic
907392799 1:54169212-54169234 GCTCATCTATAAAATGGGAATGG - Intronic
907504622 1:54908922-54908944 GCTTATCTGTAATATGGAGCTGG + Intergenic
907715857 1:56925405-56925427 CCTCATCTGTGAGATGGGGATGG - Intergenic
907913252 1:58845552-58845574 TTTTATGTGCAAAATGGGGCAGG + Intergenic
907922505 1:58926821-58926843 TGTTTTTTGAAAAATGGGGAGGG - Intergenic
908029826 1:59987416-59987438 TCTCACCTGTACAATGGGCATGG + Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908423570 1:63983209-63983231 CCATATCTGTAAAATGCGGAGGG - Intronic
908570794 1:65408019-65408041 CCTCATCCATAAAATGGGGATGG - Intronic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908811832 1:67989362-67989384 TCTCTTCTGTAAAATAGGAATGG - Intergenic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909225904 1:73022523-73022545 TCTCATCTGTAAACTGAAGATGG - Intergenic
909391852 1:75129136-75129158 TCTCATTTGTAAAATGAAGATGG - Intronic
909484613 1:76159052-76159074 TCTTGTCCCTAAAATGGGAAAGG - Intronic
910258601 1:85275020-85275042 TATTAGCTGTAAAATGGGAATGG + Intronic
910286235 1:85557415-85557437 TCTCATCTCTCAAATGAGGATGG - Intronic
910305736 1:85761195-85761217 TCTTATTTATAAAATGGAGATGG - Intronic
910418703 1:87031253-87031275 TCTTATCTCCAAAATGGGATAGG + Intronic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911054708 1:93699973-93699995 CCTTACCTGTAAAATGGGGTGGG - Intronic
911145897 1:94552310-94552332 TCTCAAGGGTAAAATGGGGAAGG - Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911587977 1:99713189-99713211 ACTCACCTGTAAAATGGGGGTGG - Intronic
911967556 1:104386878-104386900 GCTTATCTGTAATATGGAGCTGG - Intergenic
912324417 1:108744473-108744495 TCTCATATGTAAAATGGCAATGG + Intergenic
912363963 1:109117594-109117616 CCTGATCTGTGAAATGGGGATGG + Intronic
912466584 1:109878876-109878898 TCTCTTCTGTAAAATGGGAAGGG - Intergenic
912563790 1:110570384-110570406 TTTGATCTGGAAAATGGGGATGG + Intergenic
912627353 1:111216535-111216557 TTTTCCCTGTAAAATGGGGAAGG + Intronic
913276169 1:117140328-117140350 TCTCCTCTATAAAATGGTGATGG + Intergenic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
913451537 1:118996103-118996125 TCTCATGTGTAAAATGGGGCCGG - Intergenic
913539664 1:119806574-119806596 TCTTCTCTGTACAATGGAAATGG - Intronic
915146593 1:153799328-153799350 TAAAATCTGTAAATTGGGGATGG + Intergenic
915147804 1:153805717-153805739 TCTTATCTGTGAAGTGAAGAGGG - Exonic
915632770 1:157164565-157164587 TCTTTTCTGTAAAGTGGGCATGG + Intergenic
915750074 1:158199031-158199053 TATTCTCAGTAAAATGGGAATGG - Intergenic
916014973 1:160741865-160741887 TCTTATCTGTGAAATGGGATTGG + Intronic
916025681 1:160831502-160831524 TTAAATCTGTAAAATGGGGATGG - Intronic
916177664 1:162056054-162056076 TGTGTTCTGTAAAATGGGGGTGG + Intergenic
916389305 1:164313636-164313658 TCCTGTCTATAAAATGGGGCTGG - Intergenic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
916582666 1:166122702-166122724 TCTTAGCTGCCAAATGGGGATGG + Intronic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
916725693 1:167520679-167520701 TATTATCTGAAAAGTGGTGATGG + Intergenic
917087639 1:171319557-171319579 TCTCACCTGTAAAATGTGAATGG - Intronic
917268899 1:173251649-173251671 CCTTATATGTACAATAGGGATGG + Intergenic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
917634936 1:176926191-176926213 CGTTATCTATAAAATGGGGAGGG + Intronic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
917985898 1:180318261-180318283 TTTTATCTTTAAAATGTTGAGGG - Intronic
918073510 1:181151447-181151469 TCTTATCTGTGAAATGGGAATGG + Intergenic
918324110 1:183393322-183393344 CCTCATCTGTAAAATGGGATTGG - Intronic
918427362 1:184424320-184424342 TCCTATCTGTAAAGTGATGAGGG - Intronic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
919238182 1:194873679-194873701 TCTGATATGTAAAATCTGGATGG + Intergenic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920101513 1:203519917-203519939 TCTTAACTGTAAAACGCAGATGG - Intergenic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920246488 1:204591503-204591525 TCTAATCTTTAAAATGGGCTGGG + Intergenic
920255014 1:204648826-204648848 AGTTAGCTGTAAAGTGGGGAAGG - Intronic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920712370 1:208307330-208307352 TCTCATCTGTAAAAGGGGCTTGG - Intergenic
920878670 1:209860183-209860205 TGCTATCTGTAAAATGGGGATGG + Intergenic
920977851 1:210802700-210802722 TCCCACCTGTAAAATGGAGAGGG - Intronic
920987562 1:210904844-210904866 CCTCATCTGTAAAATGGAGGAGG - Intronic
921075306 1:211695841-211695863 CCTCATCTGTAAAATAGAGATGG - Intergenic
921125930 1:212178126-212178148 CCTTAGTTATAAAATGGGGACGG - Intergenic
921260959 1:213384689-213384711 CCTTGTCTGTAGAATGGAGATGG - Intergenic
921300178 1:213744579-213744601 CTTTATCTGTAAAATGGGGCTGG + Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921374331 1:214458575-214458597 TCTTATCTGTAAAATGGAGATGG - Intronic
921476033 1:215610772-215610794 TTTCATCTGTAAAATGGAGATGG + Intronic
921549391 1:216515108-216515130 TCTCATCTGTAAAATAAGGCAGG - Intronic
922023354 1:221727035-221727057 GCTTGTCTATAAAATGGGGAGGG - Intronic
922053166 1:222014440-222014462 CTTTACCTGTAAAATGGAGAGGG - Intergenic
922224944 1:223637900-223637922 TCTAATCTGTAAAATGAGTTTGG + Intronic
922350772 1:224733211-224733233 TCTCATCGGTGAAATGGGGATGG - Intronic
922357446 1:224789776-224789798 TCTCAACTGTAAAATGGGTGTGG - Intergenic
922628446 1:227078026-227078048 ACTTATTTGTAAGATGGAGAAGG - Intronic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923674336 1:236066603-236066625 CCTTCTCTGTAAAACAGGGAAGG - Intergenic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924094045 1:240532730-240532752 TCTTCTCTATGAAATGGTGATGG - Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924290280 1:242529456-242529478 CCTCATCTGTAACATAGGGATGG - Intergenic
924442194 1:244095818-244095840 CCTCAACTGTAAAATGGGGGTGG - Intergenic
924588905 1:245384585-245384607 CCTTATCTTTAAAATGAGAATGG - Intronic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1063438039 10:6050331-6050353 CCTCATCCGTAAAATGGGAATGG + Intronic
1064120510 10:12614175-12614197 CCTTATCTCCAAAATGGGCATGG + Intronic
1064220096 10:13432932-13432954 TCTCACCTGTGAAGTGGGGATGG + Intergenic
1064582505 10:16808580-16808602 TCTCATCTATAAAATGCTGACGG + Intronic
1065263655 10:23952665-23952687 CCTAACCTGTAAAATGGGAATGG + Intronic
1065281111 10:24139663-24139685 TCCTATCTGTGAAATGGAGATGG + Intronic
1065722568 10:28640973-28640995 TCTCATTTGTAAAATGCAGATGG + Intergenic
1065758728 10:28961111-28961133 TCTAATACTTAAAATGGGGAAGG + Intergenic
1065892813 10:30135553-30135575 TCTGATCTATAAAATGGGCATGG - Intergenic
1066213553 10:33264018-33264040 TCATATTAGTAAAATGGGTATGG + Intronic
1067688231 10:48480750-48480772 TCTCATCTGTAAAATGTGGTTGG - Intronic
1067844899 10:49711829-49711851 TCTCACCTATAAAATGGGGGTGG + Intergenic
1067897316 10:50197629-50197651 TCTCATTTGCAAAATGGGAATGG - Intronic
1067951656 10:50744391-50744413 TCTCATTTGCAAAATGGGAATGG + Intronic
1067989307 10:51192343-51192365 TCTTATCTGTAAAATAGAATGGG + Intronic
1068151176 10:53134144-53134166 ACTTATCTGTAAAATAGAAACGG - Intergenic
1068635603 10:59344673-59344695 TCCTATCTTTAAACTGGAGATGG - Intronic
1068785551 10:60968614-60968636 TCTGATTTTCAAAATGGGGAGGG + Intronic
1069007163 10:63330717-63330739 TATTATCTGTGAAAAGGGGGTGG - Intronic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069743864 10:70702569-70702591 TCTTATCTGTAAAATGGGACTGG + Intronic
1069859691 10:71462628-71462650 TCTTATCTGTCAGATGGAGCTGG + Intronic
1069888399 10:71638146-71638168 CCTCATCTGTGAAGTGGGGAGGG - Intronic
1070370986 10:75781798-75781820 TCTCATCTGCAAAATGGGAGTGG - Intronic
1070372999 10:75803243-75803265 ACTTATCTGTCAAATGAAGATGG + Intronic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1070483938 10:76911942-76911964 TCTTATCAGGAAGATGGGGAAGG + Intronic
1070545991 10:77452966-77452988 TCTCATCTGGAAAACAGGGATGG + Intronic
1070653653 10:78255818-78255840 CCTTACCTGTGAAACGGGGATGG + Intergenic
1070695518 10:78560492-78560514 TCTTGACTGTAAAATGGGAGAGG + Intergenic
1070726567 10:78795516-78795538 TATCATCTGTAAGATGGGGATGG + Intergenic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1071275133 10:84047253-84047275 CCTGTTCTGTAAAATGGAGATGG + Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071306234 10:84301086-84301108 TCCTATATTTAAAATGAGGATGG - Intergenic
1071437202 10:85658404-85658426 TTTAATCTGTAAAATGAGGGGGG - Intronic
1071549260 10:86553713-86553735 TCTCATCTGAAGACTGGGGATGG + Intergenic
1071572458 10:86705496-86705518 TGCTAACTGTAAAATGGGGTGGG - Intronic
1071782478 10:88861736-88861758 TCTCATCTGTTAAAAGGGGATGG - Intergenic
1072043107 10:91628112-91628134 TCTCAGCTTTAAAATGGGGAAGG - Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072202525 10:93173778-93173800 TCTCATCTATAAAATGGAGATGG + Intergenic
1072244486 10:93530461-93530483 TCTCATCTGAAAAATGGTGCTGG - Intergenic
1072258937 10:93648895-93648917 TTCTATGTGTAAAATGGGGCAGG - Intronic
1072483160 10:95829009-95829031 TGTTATCTATAAAATGGGCATGG - Intronic
1072618965 10:97067478-97067500 TCTCCTTTGTATAATGGGGATGG - Intronic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073044893 10:100631146-100631168 CCTCATCTGTAAAACAGGGATGG + Intergenic
1073052636 10:100678233-100678255 TCCTACCTGTAAAATAAGGAGGG - Intergenic
1073069765 10:100785923-100785945 TCTCCTCTGTAAAATGAAGATGG + Intronic
1073118039 10:101103442-101103464 CCTCATCTGTGACATGGGGATGG + Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073189131 10:101637754-101637776 CCTTATCTCTAAAAGGAGGAGGG - Intronic
1073426850 10:103460146-103460168 CCATCTCTGTAAAATGGGGATGG - Intergenic
1073584658 10:104698204-104698226 CCACATCTGTAAAATGGGGCTGG - Intronic
1073586943 10:104719588-104719610 CCTTCTCCGTTAAATGGGGATGG + Intronic
1073608323 10:104918284-104918306 TCTCATCTGTAAAATGTTGTTGG - Intronic
1073913708 10:108377443-108377465 TCTTAATTGTAAAATGAAGATGG + Intergenic
1074063772 10:109993866-109993888 CCCTATCTGTAAAATGGATATGG - Intergenic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074309334 10:112308673-112308695 TGTCATCTGCAAAATGGGGGTGG - Intergenic
1074375687 10:112939229-112939251 CCTTATCTGTAAAACAGGGTTGG - Intergenic
1074446402 10:113524688-113524710 ACCCATCTGTACAATGGGGATGG - Intergenic
1074455982 10:113595414-113595436 TTTTATCTGCAAAATGGTAATGG - Intronic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074870922 10:117575430-117575452 TGTCATCTGTAACATGGGGTTGG + Intergenic
1074889927 10:117727155-117727177 CCTCATCTATAAAATGGGGCAGG + Intergenic
1074913886 10:117937647-117937669 TCTCATCTGTAAAATGTTGATGG - Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1074944284 10:118266149-118266171 CCTCATCTGTAAAATGGCAAAGG + Intergenic
1074951415 10:118340833-118340855 TCCCATCTGTAAATTGGGGGCGG - Intronic
1075080334 10:119379243-119379265 TCTAGTCTGTAAACTGCGGACGG - Intronic
1075251910 10:120886337-120886359 TTTTATCTGTAAGATTGGTATGG - Intronic
1075406348 10:122198322-122198344 CCTTATCTGTGAAATGAAGAGGG + Intronic
1075444735 10:122505530-122505552 CCTCATCTGTTAAATGGGCATGG + Intronic
1075545779 10:123353378-123353400 TCCCATCTGTAAAATGAGGGTGG + Intergenic
1075712634 10:124538739-124538761 ACTTTTCTGTAAAATGGGATGGG - Intronic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1075877678 10:125822094-125822116 TTTTCTCTGTAAAATGAGGGGGG - Intronic
1076111261 10:127861446-127861468 CCTCATCTGTAAAATGGAGTGGG - Intergenic
1076230279 10:128814635-128814657 TCTGTTCTGTACAATGGAGAGGG - Intergenic
1076825757 10:132967120-132967142 TCTTATAAGTGAAATGGGAAAGG + Intergenic
1077240023 11:1505779-1505801 CCTTATCAGTAAAATGGGCAGGG - Intergenic
1077273652 11:1693461-1693483 TCTGACCTGTAAAATTGTGATGG - Intergenic
1077852609 11:6088174-6088196 TCTTTTCTGTAAAATGTGCTAGG - Intergenic
1078107038 11:8365082-8365104 TTCTATCTGTAAAATGGGTTGGG - Intergenic
1078107476 11:8367700-8367722 CCTCATCTGTAAAATAGGAATGG - Intergenic
1078349489 11:10580933-10580955 TCTCATCTGTAAAAGAGAGAGGG + Intronic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078434591 11:11314016-11314038 CCTGATCAGTAAAATGGGGGCGG - Intronic
1078451019 11:11440863-11440885 TCCTATCTGTAAATTAGGGATGG - Intronic
1078527608 11:12112058-12112080 CCCCATCTCTAAAATGGGGAGGG - Intronic
1078577846 11:12516811-12516833 TCTTATCTGTAAAACAGGGATGG - Intronic
1078677499 11:13436542-13436564 TCTCAGCTGTAAAATTGGGGTGG - Intronic
1078700346 11:13674446-13674468 CCTCATCTGTAAAATGGAGGGGG + Intronic
1078727600 11:13945572-13945594 CCTCATCTATGAAATGGGGATGG + Intergenic
1078985930 11:16597417-16597439 TCTAATTTTAAAAATGGGGATGG - Intronic
1079004016 11:16779961-16779983 TTTCATCTCTAAAACGGGGAGGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079051673 11:17166163-17166185 CCTCAACTGTAAAATAGGGATGG + Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079148673 11:17877483-17877505 GCTCATCTTTAAAATGGGGAGGG - Intronic
1079195580 11:18323479-18323501 TAGCATCAGTAAAATGGGGATGG + Intronic
1079243160 11:18735005-18735027 CCTTATCTGTAATCTGGGGATGG + Intronic
1079327776 11:19509158-19509180 CCTCTTCTGTAAAATGGGGTTGG + Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1079479667 11:20865998-20866020 TCTTTTCAGTAAAATGGGGATGG + Intronic
1079636491 11:22748259-22748281 TATTATCTGTAAAAGTGAGAGGG + Intronic
1079982067 11:27161728-27161750 TATTATCTATAAAAGGGAGATGG - Intergenic
1080061317 11:27959840-27959862 TCTTATCTTTAATATGAGGGTGG + Intergenic
1080181634 11:29432806-29432828 TCTCATCTGTAAAATGAGCTAGG + Intergenic
1080197944 11:29633511-29633533 ACTTTTCTGCAAAATGTGGAAGG + Intergenic
1080302654 11:30801292-30801314 TCTCATCTGTAAAATGGAAATGG - Intergenic
1080357237 11:31464203-31464225 TCTTGTCTATAAATTGAGGATGG - Intronic
1080682643 11:34490650-34490672 TCTCCTCTGTAGAATGGGGTGGG + Intronic
1080801169 11:35611643-35611665 ACTCATCTGTAGAATGGAGATGG - Intergenic
1080805563 11:35650039-35650061 TCATACATGTAAAATGGGGAAGG - Intergenic
1080913083 11:36625406-36625428 TCTTATCTGTAGAGTGGTGAGGG - Intronic
1081612732 11:44572756-44572778 CCTCATCTGTGAAATAGGGATGG + Intronic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081679657 11:44992709-44992731 TCTCATCTGTAAAATAGGGTTGG + Intergenic
1081760798 11:45575346-45575368 CTTTATCTCTAAAATGGGGGTGG - Intergenic
1081894192 11:46570578-46570600 TTTTGTCTGTAAAATGGGAGTGG - Intronic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1082790770 11:57345487-57345509 TCTCATCTGTCGAATGGGAATGG + Intronic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083122164 11:60524446-60524468 TTTTATCTGTAAAATTATGAGGG - Intronic
1083138304 11:60700644-60700666 TCTCATCTGTAAAACTGGGCGGG + Intronic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083275542 11:61595078-61595100 TCTCATCTGTAAAGTAGGGGCGG + Intergenic
1083276166 11:61598219-61598241 CCTCATCTGTCAAATGGGGTGGG - Intergenic
1083622857 11:64057536-64057558 TCTCATCTGTAAAATGGGCGTGG - Intronic
1083767286 11:64847674-64847696 CCTTGTCTGTAAAAGGGGGTTGG + Intergenic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1083934181 11:65861816-65861838 CCTTCTCTGTAAAATGGGCCAGG - Intronic
1084146584 11:67268131-67268153 TCTCATCTGTGAAATGTGGATGG + Intronic
1084576019 11:69988396-69988418 CCTTATCTGTAAAGTCCGGAGGG + Intergenic
1084728214 11:71055861-71055883 TCTTAGCTAGACAATGGGGATGG + Intronic
1084942182 11:72618702-72618724 TCTCATCTGAAAAATGGAGGTGG - Intronic
1085395444 11:76204930-76204952 CCTTATCTGTAAAATGGTGGCGG + Intronic
1085425878 11:76404251-76404273 TCTTATTTATAAAATGGAGATGG - Exonic
1085426990 11:76413493-76413515 CCTCATCTATAAGATGGGGATGG + Intronic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1085523269 11:77150403-77150425 TCTTGTTTGTAAAATTAGGAGGG + Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085640160 11:78188441-78188463 TCCCATCTGTGAAATGGGGATGG - Intronic
1085645988 11:78223255-78223277 TCTTATCTGTGAAATGCAGATGG - Intronic
1085708843 11:78811134-78811156 CCTTGTCTATAAAATGGGAATGG - Intronic
1085740056 11:79070720-79070742 TCTCATCTGTCAGATGGGGATGG - Intronic
1085798818 11:79568283-79568305 CCTAATCTGAAAAATGGAGATGG + Intergenic
1085876924 11:80418754-80418776 CCTTGTCTGTAAAATGGGAAGGG + Intergenic
1085931511 11:81088857-81088879 TCTTATCTGTAAAACAGGAATGG + Intergenic
1085962986 11:81484876-81484898 TCATATCTATAAAATTGAGATGG - Intergenic
1086065257 11:82736946-82736968 CCTTATCTGAAAAAAGGGAATGG + Intergenic
1086095433 11:83045674-83045696 CCTCAGCTGTAAAATGGGTATGG + Intronic
1086098356 11:83072351-83072373 TCTTAGCTAAAAAATGGAGAAGG - Intergenic
1086149856 11:83597113-83597135 TTGTATCTATAAAATAGGGATGG + Intronic
1086157127 11:83679797-83679819 CTTTATCTGTAAAATGGAGGAGG - Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1086871857 11:92047417-92047439 TCTTATATGGTAAATGGTGAAGG - Intergenic
1086948880 11:92870937-92870959 CTTTATCTGTAAAATGAGGGTGG - Intronic
1087151746 11:94866277-94866299 ACTCATCTGTGAAGTGGGGAGGG + Intronic
1087283232 11:96235581-96235603 TCTTATTTGTAAAGTAAGGAGGG + Intronic
1087624022 11:100575005-100575027 TCTAATTTATAAAATGGGGATGG - Intergenic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1087920237 11:103858587-103858609 TGTAATCTGTAAAATGAGGAAGG + Intergenic
1088314687 11:108496157-108496179 TTATATTTTTAAAATGGGGATGG + Intronic
1088368189 11:109060740-109060762 TCTCACCTGTAAAATGGGGTTGG + Intergenic
1088420738 11:109643224-109643246 TCTTAGATGGAAAATGGGGAAGG + Intergenic
1088466901 11:110149290-110149312 TCTTATCTTTTAAACGGCGAGGG - Intronic
1088739797 11:112757885-112757907 TCTTCTCTGTAAAATGGGAATGG + Intergenic
1088782950 11:113153881-113153903 TCTCATTTATTAAATGGGGATGG + Intronic
1088824058 11:113478750-113478772 TCTCATCTGAAAGGTGGGGAAGG + Intergenic
1088890319 11:114038882-114038904 TCTCATCTGTAAAATGGAGCTGG - Intergenic
1089342505 11:117768016-117768038 CCTCACCTGTAAAATGGGCAAGG + Intronic
1089480666 11:118802360-118802382 TCTCATCTGTTTAATGGGGATGG + Intergenic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089775986 11:120836294-120836316 CCTCAGCTGTAAAATGGGGTTGG + Intronic
1089799183 11:121010424-121010446 TTTTTTTTGTAAAATGGGCATGG + Intergenic
1090007458 11:123015728-123015750 TCCCATCTTTAAAATGGAGATGG + Intergenic
1090213719 11:124941967-124941989 TCTTGTTTGTAAGATGGGGTTGG - Intergenic
1090281091 11:125456366-125456388 TCTATTCTCAAAAATGGGGATGG + Intronic
1090358320 11:126155565-126155587 TTCCATCTGTAAAATGGGGATGG - Intergenic
1090429734 11:126635716-126635738 CCTTATCTGTAAAATGTGGCTGG + Intronic
1090468593 11:126957884-126957906 TCTCTTCTGTAAAATGGTCAGGG + Intronic
1090507868 11:127338759-127338781 TCCTGTCTGGAAAATGGTGATGG - Intergenic
1091056659 11:132425475-132425497 TTTTATGTATAAAATGTGGAAGG + Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1091992266 12:4964957-4964979 TCTCATCTGTAAAATGGCACCGG - Intergenic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092072950 12:5648122-5648144 TTTCATCTGTAAATTGGGCACGG + Intronic
1092295377 12:7193119-7193141 CCTCATCTATAAAATGGGGGTGG - Intronic
1092411611 12:8257451-8257473 CCTCATCTGTAACTTGGGGATGG + Intergenic
1092728274 12:11505382-11505404 TCTTGTCTGGAAAATGGGGTTGG - Intergenic
1093484406 12:19637932-19637954 CTTTTTCTGCAAAATGGGGATGG + Intronic
1093818428 12:23579589-23579611 TCTTAACTATAAAATGGACATGG + Intronic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1094591114 12:31821719-31821741 TCTTTTGTGTATAATGGGGTTGG + Intergenic
1095481358 12:42639278-42639300 CCCTATTTGTAAAATGAGGAGGG - Intergenic
1096323800 12:50640192-50640214 TCTTATCAAGAATATGGGGATGG - Intronic
1096510607 12:52125861-52125883 CCCTATCTGTAAAACAGGGATGG + Intergenic
1096525897 12:52210162-52210184 TGTCATCTGTAAAGTGGGGCTGG + Intergenic
1096655218 12:53086059-53086081 TCTTATCTACAAAGTGGAGATGG + Intergenic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096815410 12:54198821-54198843 CCTCATCTATAAAACGGGGATGG - Intergenic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1097811393 12:64023058-64023080 CTTTATCAGTGAAATGGGGATGG + Intronic
1097915598 12:65017629-65017651 TCTCATCTGTAAAATGATGCTGG + Intergenic
1098306373 12:69106855-69106877 TCTTATCTGTGCAATGAGTATGG + Intergenic
1098457008 12:70685851-70685873 TCCTATCTGAAAAATGGGGAAGG - Intronic
1098604776 12:72376911-72376933 CCTTATCTGTAAAATGGGATTGG + Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1098720454 12:73891147-73891169 TCTAATCTATAAAATGAGAATGG + Intergenic
1098892115 12:76019991-76020013 TTTTCACTGTAAAATGGGGAAGG + Intergenic
1099087267 12:78261043-78261065 GTTTGTCTGTAAAATGGAGATGG + Intergenic
1099144044 12:79016465-79016487 TGTTATTTATAAATTGGGGAGGG + Intronic
1099201563 12:79683913-79683935 TTTTCTCTGTAAAGTGGGAAAGG + Intronic
1100210803 12:92396633-92396655 TCTTGTCTGTAAAATAGTGCTGG - Intergenic
1100271783 12:93032399-93032421 CCTTGTCTATAAAATGGGCATGG - Intergenic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1100363318 12:93897650-93897672 TCTTATCTATAAAATAGAAAAGG - Intergenic
1100367683 12:93936630-93936652 TCTCATCTGTAAGATGGAGATGG - Intergenic
1100459500 12:94785185-94785207 TCTAATCTGTAAAATGGAGATGG + Intergenic
1100585257 12:95973417-95973439 CCTTATCTGTGAAATGAGGAAGG + Exonic
1100769549 12:97906468-97906490 TCTTAACTGAAAAATGTAGATGG - Intergenic
1100820889 12:98428544-98428566 TCTTATCTCTAAAACGGGGATGG - Intergenic
1100917815 12:99446502-99446524 GTTTCTCTGTAAAATAGGGATGG - Intronic
1101056089 12:100915498-100915520 TCTTTTCTGTGACATGGGGAGGG + Intronic
1101169766 12:102078632-102078654 TCTCATTTCTAAAATGGAGATGG + Intronic
1101330766 12:103755922-103755944 CCTCATCTATAAAATGGAGATGG + Intronic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101438491 12:104684433-104684455 TATCATCTGTAAAAAGGGGATGG + Intronic
1101593413 12:106141853-106141875 TCTAATCTGCAAAGTGGCGATGG + Intergenic
1101727724 12:107402168-107402190 TCCCATCTGTAAAATAGGGTTGG - Intronic
1101827447 12:108231507-108231529 CCTCATCTGTAAAATGGGTTGGG - Intronic
1101827537 12:108232235-108232257 TCTCATCTGTAAAATGGGTTGGG + Intronic
1101841579 12:108331249-108331271 TCCCATCTGTGAAATGGGGATGG - Intronic
1101876631 12:108600336-108600358 CCTCCTCTGTAAAATGGAGATGG + Intergenic
1101889639 12:108701663-108701685 TCTTATCTGTAAAAGGGGAAGGG - Intronic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102044700 12:109822489-109822511 TCTTACCTGGAAGGTGGGGAGGG - Intronic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102199294 12:111046415-111046437 GTTCATCTGTAAAATGGGAATGG - Intronic
1102230854 12:111261234-111261256 TCTAATCTGTATGATGGGGCAGG + Intronic
1102469247 12:113150294-113150316 CAGCATCTGTAAAATGGGGAGGG + Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102560225 12:113756789-113756811 TCCCATCTGTAAAATGGGGCTGG - Intergenic
1102568566 12:113813199-113813221 TCTAATCTGTAAAATGATGGGGG + Intergenic
1102725768 12:115063276-115063298 TTTTATTTGTAAAATGGGGATGG + Intergenic
1102856812 12:116301303-116301325 TATTATCTGTAAAAATGGAAAGG - Intergenic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1102996524 12:117355656-117355678 TCTTATCTGTGAAATGGAGTTGG - Intronic
1103079358 12:118011089-118011111 TCACATCTGTAAAATGGGCAGGG - Intergenic
1103140535 12:118544280-118544302 TCTCATCTGTAATATGGGGCTGG - Intergenic
1103236075 12:119373686-119373708 CCTTATCTGTAAAATGAGATGGG + Intronic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103370710 12:120417023-120417045 CCATATCTGTGAAATGGGCAGGG + Intergenic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103594270 12:122014127-122014149 TCTTTTCTGTAAAAGGAGGGAGG + Intergenic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1103718797 12:122962334-122962356 TCATATCTGCAAAATGGGCTGGG + Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104096592 12:125563742-125563764 TCTTATCAGAAAAAAGGAGAGGG + Intronic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104199012 12:126568956-126568978 CCTGATGTGGAAAATGGGGAAGG + Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1104528717 12:129548848-129548870 TCTTGTTTGTAAAATGAGAAAGG - Intronic
1104656469 12:130577188-130577210 TCTCATCTGTAAAACAGGGATGG + Intronic
1104784021 12:131438273-131438295 TCCTCTCTGTCAAATGGGAATGG - Intergenic
1104848804 12:131861130-131861152 TCTGATCTGTAAACTGGGTGTGG + Intergenic
1105032640 12:132894809-132894831 GCTTATCTGTAATATGGAGCTGG - Intronic
1105519579 13:21119976-21119998 TTTTATTTATAAAACGGGGAGGG - Intergenic
1105545150 13:21345810-21345832 TCTTATTTGTAAGCTGGGGATGG - Intergenic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1105826020 13:24124296-24124318 TCTCATCTATAAGATGAGGAAGG + Intronic
1106025671 13:25953318-25953340 TTTCTTCTGTAAAATGGGGACGG + Intronic
1106327922 13:28711902-28711924 TCTCATCTGTAAAATGGGCGTGG - Intronic
1106418212 13:29563757-29563779 TCTCATCCATAAAGTGGGGATGG - Intronic
1107145680 13:37058493-37058515 TCTTGTCACTAAATTGGGGATGG + Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107420080 13:40237966-40237988 TCTTATTAATAAAATGGGGGTGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1108735018 13:53274521-53274543 TCTTATCTCAAAAGTGAGGAAGG - Intergenic
1109007545 13:56898785-56898807 GCATAGCTGTAAAATAGGGATGG + Intergenic
1109376099 13:61495266-61495288 CCTTATCTGTAAAATAAAGATGG - Intergenic
1109566757 13:64128007-64128029 TCTTATCTGTAAAAAGGATGTGG + Intergenic
1109587094 13:64420167-64420189 TATTAGCTGTAAGAAGGGGAAGG + Intergenic
1110105027 13:71662463-71662485 ACTCATCTGTAAAATGGAAATGG + Intronic
1110684205 13:78352432-78352454 TATTATCAGTAAAAGGAGGAAGG - Intergenic
1110771446 13:79352715-79352737 ACTCATCGGTAAAATGGTGATGG - Intronic
1111649893 13:91076247-91076269 CCTTCTCTGTGAAATGTGGAAGG + Intergenic
1111861733 13:93715730-93715752 TCTCATGTGCAAAATGGGAATGG + Intronic
1112042079 13:95556593-95556615 TCTCATCTGTAAAACAGGGATGG - Intronic
1112262757 13:97892419-97892441 TCTCATCTGTAAAATGGATATGG - Intergenic
1112329605 13:98467060-98467082 TCTCATCTGTAGAATGGAGGTGG + Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113333200 13:109352173-109352195 ACTCATCTGTAAAATGGAGATGG - Intergenic
1113546504 13:111154874-111154896 TCTTATCTGTAAACTGAGATGGG + Intronic
1113907675 13:113827521-113827543 CCTTATCTGTGAAACGAGGAGGG + Intronic
1114068864 14:19092522-19092544 CCTTATTTCTAAAATAGGGAAGG - Intergenic
1114093397 14:19307483-19307505 CCTTATTTCTAAAATAGGGAAGG + Intergenic
1114174382 14:20306992-20307014 CGTTAGCTGTAAAATAGGGAGGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114516633 14:23303826-23303848 TCTTATCTGTAAAAAAGTGGTGG + Intronic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1114839890 14:26251136-26251158 TCTTATCTATGAAATGGCAATGG - Intergenic
1115509636 14:34126974-34126996 TCTCATCTGTAAAATAAGAATGG - Intronic
1115513502 14:34161492-34161514 ACTCATCTATAAAATGGGGATGG + Intronic
1115853263 14:37603914-37603936 TCCCAACTGTAAAATGGGCATGG + Intronic
1115890449 14:38021553-38021575 TCTTGTCTCTAAAATGTGGATGG + Intronic
1115979567 14:39035382-39035404 TCTTATATTTAACATGGGAAAGG - Intronic
1116001968 14:39253416-39253438 CCTAATTTGAAAAATGGGGAGGG - Exonic
1116797739 14:49410026-49410048 TATTATAGGTAAAATCGGGAAGG - Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116825604 14:49670527-49670549 TCCTATCTATAGAAGGGGGAAGG - Intronic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1117332221 14:54724378-54724400 TGCTATCTGTGAAATGGGGGTGG + Intronic
1117572241 14:57058908-57058930 TTTCATCTGTAAAATGGGCATGG - Intergenic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1117852257 14:59986819-59986841 CCTTATCTGTAAAATGACTAAGG - Intronic
1118055887 14:62079432-62079454 CCTCAACTGTAAAATGGAGATGG - Intronic
1118147784 14:63158583-63158605 TCTCATCTGTAAAATGGAAGGGG + Intergenic
1118313254 14:64708203-64708225 TCCTATCTGTAGGATGGGGGTGG - Intronic
1118314148 14:64715514-64715536 CCTGACCTGTAAAATAGGGATGG + Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118386108 14:65256854-65256876 TCATACCTGTGAAATGGGTATGG - Intergenic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118608173 14:67518343-67518365 TCTCATCTGCAAAATGGAAATGG + Intronic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1118920752 14:70147742-70147764 TCTTATCTGAAGCATGGGGGTGG - Intronic
1118948864 14:70415957-70415979 TATCATCTCTAAAATGGGGATGG - Intronic
1119060536 14:71469693-71469715 TCTCATGTGAAAAATGAGGAAGG + Intronic
1119277004 14:73366559-73366581 TCCTATCTGTAAAATTGTGATGG - Intronic
1119408104 14:74411216-74411238 CCTTATCTGTAAGGTGTGGATGG + Intronic
1119574389 14:75705578-75705600 TTTAATCTATAAAATGTGGATGG + Intronic
1119643736 14:76333978-76334000 CCCCATCTGTAAAATGGGGCAGG + Intronic
1119804224 14:77472055-77472077 TGTTATCAGTAAAATGGCAATGG - Intergenic
1119902496 14:78273292-78273314 CCTTATCTGTAAAATGAGTGTGG + Intronic
1119996950 14:79263587-79263609 TCTCCTCTGTAAAATGAGGGAGG + Intronic
1120115985 14:80617973-80617995 TTTCATCTATAAAATGGGGATGG + Intronic
1120301677 14:82715140-82715162 TCTTTTCTGGAAAATAGTGATGG + Intergenic
1120319349 14:82939712-82939734 TCTCATCACTAAAATGGGGATGG + Intergenic
1120414332 14:84200391-84200413 ACTTATCTGTGAAACGGTGACGG + Intergenic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1120599402 14:86482666-86482688 TCTCATCTGTAAAATGGAAATGG - Intergenic
1120657914 14:87217572-87217594 TCTTATCTGTAAAATAATAATGG + Intergenic
1120719441 14:87874459-87874481 TCTTATCTACAAAATGGGGGTGG + Intronic
1120841602 14:89090326-89090348 GCTCATCTGTAAAATGGAGTTGG - Intergenic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121126823 14:91413329-91413351 CCTGATCTGTAATAAGGGGATGG - Intronic
1121258209 14:92546941-92546963 TCTTATTTGTACAATGGAGCTGG - Intronic
1121314036 14:92950563-92950585 CCTCATCTGTAAAACGGGAAGGG - Intronic
1121319856 14:92985894-92985916 TCCTATCTGTAAAATGGGGAGGG - Intronic
1121392912 14:93591217-93591239 TGCTCTCTGTAAAATGGAGATGG + Intronic
1121439511 14:93939866-93939888 CCTTATCTGTAAAGCGGAGACGG - Intronic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121702257 14:95963489-95963511 ACTCATCCGCAAAATGGGGATGG - Intergenic
1121859372 14:97302203-97302225 TCTTATCTTTAAAATGAGAGAGG + Intergenic
1121907560 14:97760965-97760987 TCTCTTCTGGGAAATGGGGATGG + Intronic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122094130 14:99358935-99358957 TCTTCTCTGTAAAGTGAGGAAGG - Intergenic
1122834759 14:104425236-104425258 TCTTATCTGGGAAATGGGTGTGG - Intergenic
1122835492 14:104428697-104428719 TCCTCTCTATAAAATGGGAAGGG + Intergenic
1123682744 15:22774329-22774351 TCACACCTGTAAAATGGGGATGG - Intronic
1123711914 15:22994389-22994411 TCCTATCTGTAAAATGGACTGGG - Intronic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1124026646 15:25972985-25973007 TCTCTTCTTCAAAATGGGGAGGG + Intergenic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124517508 15:30379510-30379532 CCTCATCTGTAAAATTGCGATGG - Intronic
1124541142 15:30586745-30586767 CCTCATCTGTAAAATTGCGATGG + Intergenic
1124655407 15:31503096-31503118 TCATCTCTGTAAAGTGGGGAGGG + Intronic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1124841094 15:33242923-33242945 CCTCATTTGTAAAATGGAGAGGG - Intergenic
1124872925 15:33561481-33561503 TCTCCTCTGTAAAATTGGAATGG + Intronic
1124884827 15:33675624-33675646 TCTCATCTATAAAATGGACATGG + Intronic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126909725 15:53404907-53404929 TCTTATCTGTAAAATGCAGATGG + Intergenic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127345657 15:58095220-58095242 TCTTATCTATAAAATGGTAATGG - Intronic
1127634654 15:60857869-60857891 TCTCATCTGTGAAATGGAGGTGG - Intronic
1127709105 15:61577990-61578012 CCTCATCTGTAAAATGGAGGTGG + Intergenic
1127829876 15:62741236-62741258 TTGTATCTGTCACATGGGGAAGG + Intronic
1127959234 15:63878764-63878786 TCTCATCGGTAAAATGGTCATGG + Intergenic
1127985090 15:64063313-64063335 TCTTACCTGTAAAATGAAGTTGG + Intronic
1128148664 15:65347371-65347393 TCTCATCTGTAAAATGGGAGTGG + Intronic
1128238206 15:66081677-66081699 TCTCATCTTTAAAGTGGGAAGGG - Intronic
1128522501 15:68385115-68385137 CTTCATCTGTAAAATGGGTATGG - Intronic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128610480 15:69069161-69069183 CTTCATCTCTAAAATGGGGATGG - Intergenic
1128619038 15:69133430-69133452 TCTCATCTGTAAAATAGGAGCGG + Intergenic
1128735696 15:70052672-70052694 TCTCACCTATAAAATGGGGATGG - Intronic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128816166 15:70610147-70610169 TCTCATCTGTAAACTGGGTCAGG + Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1128891098 15:71332432-71332454 TCTTGGCTGTAAAATGCAGAAGG + Intronic
1128904695 15:71456522-71456544 TCCCATCTGTGAAATGGGGATGG - Intronic
1128926597 15:71661920-71661942 TCTTACATGTAAAGTGGGGATGG - Intronic
1129331077 15:74827438-74827460 CCTTTTCTGGAAAGTGGGGATGG + Intronic
1129684077 15:77675086-77675108 TTTTATCTGTCAAATTGGCAGGG + Intronic
1129756828 15:78103800-78103822 GCTTATCTGGGAAATGGGGGTGG - Exonic
1129792607 15:78351398-78351420 TTTTATCTGGAAAATGCAGAAGG - Intergenic
1129961200 15:79686729-79686751 TCTCATTTGTAAAATGGTGCTGG - Intergenic
1129979104 15:79850078-79850100 TCTCATCCGTAAAATGGAGCTGG + Intronic
1130097520 15:80867078-80867100 GCAAATCTGTAAAATGGGGAGGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130193896 15:81761268-81761290 TATTATCTGTAGAACGGGGATGG - Intergenic
1130393475 15:83480405-83480427 TCTCATCTGTGAAATTGGGATGG - Intronic
1130519018 15:84648089-84648111 CCTTATCTGTGAAATGAGGGTGG - Intronic
1130867145 15:87942736-87942758 TCTCACCTGTAAAATGGGTATGG + Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1130927039 15:88393300-88393322 CTTTATCTGTAATATGAGGATGG + Intergenic
1130960554 15:88656026-88656048 TCCTATTTGTAAAATGAGGAAGG + Exonic
1131230093 15:90653428-90653450 CCTTATCTATCAAATGGGAATGG - Intergenic
1131719396 15:95150847-95150869 TCTTCTCTGTAACATGGTGTTGG + Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132189413 15:99838395-99838417 TTTTATTTGTAAAGTGGGGTAGG - Intergenic
1132244051 15:100280743-100280765 TCCGATTTGTCAAATGGGGATGG - Intronic
1132424472 15:101703068-101703090 TCTTACAGGTAAAATGGGGCTGG - Intronic
1132895431 16:2226959-2226981 CCTCATCTGTAAAATGGGCTGGG - Intronic
1133395421 16:5443206-5443228 TCCTATCTCTAAAATGAGCACGG - Intergenic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133598743 16:7318526-7318548 TCTCATCTGTGAGATGGGGATGG + Intronic
1133683234 16:8140644-8140666 TCTCATCTGTCAAATGGGTAGGG + Intergenic
1133850707 16:9500676-9500698 TCTCACCTGTAAAATGGAGAGGG + Intergenic
1133862598 16:9610199-9610221 CCTCATCTGTTAAATGGAGATGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133897266 16:9941710-9941732 TCTCATCTATAAAATGGGTGTGG + Intronic
1133921751 16:10159622-10159644 CCTCATCTGTAAAATGGGATTGG - Intronic
1134100290 16:11447138-11447160 TCTTTGCTGTCAAATGGCGACGG - Intronic
1134114137 16:11535472-11535494 GTTTGTCTGTAAAATGGAGAGGG + Intergenic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134351662 16:13443427-13443449 TGTTATCTATAAAATGGGGATGG + Intergenic
1134483393 16:14637460-14637482 TCTCATCTGTAAAATGAACATGG + Intronic
1134784356 16:16927606-16927628 TTTCATCAGTAAAATGTGGATGG + Intergenic
1134785035 16:16934525-16934547 CCTCAAGTGTAAAATGGGGATGG + Intergenic
1134875048 16:17690720-17690742 TCTCAGCTGTGAAATGGGGGCGG - Intergenic
1135155538 16:20049769-20049791 CTTTATCTGTAAAGTGGGGATGG + Intronic
1135160156 16:20087199-20087221 CCTCATCTGTAACATGGAGAAGG - Intergenic
1135169100 16:20167219-20167241 CCCCATCTGTAAAATGGGGTAGG + Intergenic
1135194402 16:20382751-20382773 TTCCATCTGTTAAATGGGGATGG - Intronic
1135458732 16:22622625-22622647 CCTCATCTGTAAAATGGCAAAGG - Intergenic
1135514419 16:23118135-23118157 TCTTTTCTGCAAAATGGGAATGG + Intronic
1135856996 16:26020925-26020947 CCATATATGTAAAATGGGGATGG + Intronic
1135945337 16:26860119-26860141 TCCTCACTGTAAAATGGAGATGG - Intergenic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136067612 16:27769453-27769475 CCTCATCTGTTAAATGGGCACGG - Intronic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136158159 16:28399523-28399545 TCTCATCTGTAAAATAAGGCAGG - Intronic
1136204928 16:28715760-28715782 TCTCATCTGTAAAATAAGGCAGG + Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136454950 16:30375148-30375170 TCTCATTTGTAAAATGGGATGGG - Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136616181 16:31399873-31399895 TCATATCTGTAAAATGAGAATGG - Intronic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1136928256 16:34395343-34395365 TCTCACCTGTGAAGTGGGGATGG - Intergenic
1136976318 16:35016461-35016483 TCTCACCTGTGAAGTGGGGATGG + Intergenic
1137291738 16:47056129-47056151 CTTTGTCTGTACAATGGGGATGG + Intergenic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137584579 16:49656855-49656877 TCTCATCTATAAAATGGGGCTGG - Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137699314 16:50484912-50484934 CCCTGTCTGTAAAATGGGGAGGG - Intergenic
1137776858 16:51062592-51062614 TCCTATCTGTAATATGGACACGG - Intergenic
1137823072 16:51464062-51464084 TTTCACTTGTAAAATGGGGAGGG + Intergenic
1137864652 16:51880679-51880701 TGTTCTCTGTAAAATGTAGATGG - Intergenic
1137943763 16:52714450-52714472 TCTGACCTGGAAAATGAGGAGGG - Intergenic
1137988086 16:53127600-53127622 GACTATCTGTAAAATGGGGGCGG + Intronic
1137998645 16:53249338-53249360 TTGTATATGTTAAATGGGGAAGG + Intronic
1138082915 16:54108758-54108780 TCTTATCTGTCAAGTGGTGACGG - Intronic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138405795 16:56792986-56793008 TCTTACCTGTAAAATGGGGCAGG + Intronic
1138408179 16:56815761-56815783 CCTTAGCTGTAAAGTGGGGGTGG - Intronic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138576379 16:57909897-57909919 CCTCAGCTGTAAAATGGGAATGG + Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1138835629 16:60431105-60431127 TCCTATCTGTAAAATGAGGAAGG - Intergenic
1138922105 16:61543765-61543787 CCATATCTGTAAAATGGGCATGG + Intergenic
1138946447 16:61856738-61856760 GCACATCTGTAAAATGGGTATGG - Intronic
1139213426 16:65103542-65103564 TTTTGTCTGAAAAATAGGGATGG + Intronic
1139349508 16:66326410-66326432 CCTAATCTGTAACATGGTGATGG - Intergenic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1139658250 16:68402258-68402280 TCTCCTCTATAAAATGGGGAAGG + Intronic
1139824348 16:69745336-69745358 CCCCATCTGTAAAATGGAGACGG - Intronic
1140016501 16:71192043-71192065 CCTTATCTGTGATATGGGAAGGG - Intronic
1140232456 16:73128870-73128892 TCTCATCTATATAACGGGGATGG + Intronic
1140259886 16:73368845-73368867 CCTTACCAGTAAAATGGGGCTGG - Intergenic
1140589907 16:76339285-76339307 TGTTATATGTTGAATGGGGAGGG - Intronic
1140698005 16:77554185-77554207 TCTTAGCTATAAAATGGAGAAGG - Intergenic
1140838805 16:78819978-78820000 CAACATCTGTAAAATGGGGATGG + Intronic
1140971021 16:80012610-80012632 TCTTATTTGCAGAATGGGAATGG - Intergenic
1141022322 16:80508873-80508895 TCTTATCTGTGTAACAGGGATGG + Intergenic
1141050189 16:80754649-80754671 CCTTATCAGTAAAATGCAGATGG + Intronic
1141270140 16:82532121-82532143 TCTAGTCTGTGAACTGGGGATGG - Intergenic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141318527 16:82984474-82984496 TCTTCGCTGTAAAATAAGGATGG + Intronic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141638747 16:85329237-85329259 GTTCATCTGTAAAATGGGGGTGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1142363241 16:89637033-89637055 CCTTGTCTGTAAAATGGAGCTGG + Intronic
1142401819 16:89862899-89862921 TCTCTTCTGTAAAATGGGGCTGG - Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1142525671 17:538676-538698 TCTTATCTGTGAAATGAAGATGG - Intronic
1143087565 17:4427549-4427571 TCTCACCTACAAAATGGGGATGG - Intergenic
1143392374 17:6567297-6567319 CCTTATCTGTAAAATGGGAATGG - Intergenic
1143995621 17:11003964-11003986 TCTGCTCTGTAAAATGGCCATGG - Intergenic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144391264 17:14795561-14795583 TCTTGTCTGTAAAATGGAAATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144855959 17:18267950-18267972 TCTCATCTCTTAACTGGGGAGGG + Intergenic
1144950449 17:18990881-18990903 TCCTGTCTATAAAATGGGAAAGG - Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145226266 17:21130789-21130811 TCTTATGTGTATAATGGGGTGGG - Intronic
1145772818 17:27505614-27505636 CTTTATCAGTAAAATGGGGATGG + Intronic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1145973421 17:28970285-28970307 TCTCATCTGTAAAGTAGGGATGG + Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146134528 17:30307282-30307304 CCTCATCTATAAAATGGGAATGG - Intergenic
1146472275 17:33134191-33134213 TCTTATATGTAAAATGGGGATGG - Intronic
1146579708 17:34025982-34026004 TCTCATCTGTGAAATGGGTATGG + Intronic
1146594930 17:34160149-34160171 TCTCATCTGTAAAATGGGCTTGG - Intronic
1146641530 17:34545506-34545528 TCTTTTCTGTGATATGAGGAGGG + Intergenic
1146645325 17:34573371-34573393 TCTTATCTATAAAAATAGGAAGG + Intergenic
1146921024 17:36711756-36711778 TTTCACCTGTGAAATGGGGATGG + Intergenic
1146932907 17:36790863-36790885 TCTCATCTGTGAAATGGACACGG - Intergenic
1146935827 17:36812168-36812190 CCTCATCTGTGAAATGGTGATGG - Intergenic
1146950415 17:36901518-36901540 TCTTGTCTGTAAAATGGGGATGG - Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147039796 17:37709800-37709822 CCTCATCTATAAAATGGGGGCGG - Intronic
1147128736 17:38392936-38392958 CTTTATATGTGAAATGGGGATGG + Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1148173328 17:45542705-45542727 TATTATCTGTAAAATGAATAAGG - Intergenic
1148275940 17:46302746-46302768 TATTATCTGTAAAATGAATAAGG + Intronic
1148298054 17:46520320-46520342 TATTATCTGTAAAATGAATAAGG + Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148553636 17:48564954-48564976 TCTTTCCTGTAAGATGGGGGAGG + Intronic
1148588060 17:48794942-48794964 CCTCATCTGTAAGATGGAGATGG + Intronic
1148737908 17:49875142-49875164 TCTCATCTGTAAAAATGGAATGG + Intergenic
1148849233 17:50546856-50546878 TCTCATTTGTAAAATGGGCAGGG + Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148871550 17:50661399-50661421 TCTCATCTGTGACATGGGAATGG - Intronic
1148954974 17:51346032-51346054 TCTCATCTGTGAAATGAGCATGG + Intergenic
1148988610 17:51646217-51646239 TCCCATCTGTAAACTGGGGATGG + Intronic
1148992809 17:51681191-51681213 TCTGATCTGCAAAATGGGTATGG + Intronic
1149242672 17:54668661-54668683 GTTTATCTGTAAAAAAGGGATGG + Intergenic
1149315457 17:55434276-55434298 TCTCACCTGTAAAATGGGGGAGG + Intergenic
1149329132 17:55563467-55563489 ATTTATCTGTAAAATGGGGGTGG + Intergenic
1150233319 17:63571626-63571648 CCTTTTCTGAAAAATGAGGATGG + Intronic
1150322541 17:64227782-64227804 TTTCATCTGTAAAATGGGAATGG + Intronic
1150335451 17:64327375-64327397 CCTTATCTATAAAGTGGAGATGG - Intronic
1150404535 17:64889622-64889644 TATTATCTGTAAAATGAATAAGG - Intronic
1150428803 17:65099630-65099652 TGATTTCTGTAAAATGGGGATGG - Intergenic
1150802551 17:68292908-68292930 CCAGATCTGTAAAATGGGGATGG + Intronic
1151308502 17:73279277-73279299 TCCTATCTCTAAAATGAGCAGGG + Intergenic
1151340417 17:73467393-73467415 CCTCATCTGTAACATGGAGATGG + Intronic
1151352772 17:73541496-73541518 CCTTGTCTGTGAAATGGGGGTGG - Intronic
1151676576 17:75601858-75601880 CCTCACCTGTAAAATGGGTATGG + Intergenic
1151796881 17:76352792-76352814 CCTCATCTGTGAAATGGGCATGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152409714 17:80117289-80117311 GCTCATCTGGGAAATGGGGATGG - Intergenic
1152625464 17:81386258-81386280 GCTCATCTGTAAAATGGGCATGG + Intergenic
1152996814 18:415213-415235 CCTTATCTGTAAAATGGAAACGG - Intronic
1153097412 18:1423322-1423344 CCTTCTCTGTAAAATGGAGATGG + Intergenic
1153415527 18:4841746-4841768 CCTTACCAGTAAAATGAGGATGG + Intergenic
1153466088 18:5389374-5389396 GCTGATCTGTAAAATCAGGAAGG + Intergenic
1153487810 18:5618153-5618175 ACTCAGCTGTAAAATGGGGAAGG + Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1153760804 18:8330137-8330159 TTTCTTCTGTAAAATGGGGTAGG - Intronic
1153774471 18:8440576-8440598 ATGTATCTGTAAAATGGGGAGGG - Intergenic
1154238853 18:12633061-12633083 TCTTATCTATAAAATGTTAATGG - Intronic
1154318557 18:13325717-13325739 CCTCATCTGTAATGTGGGGATGG + Intronic
1154387924 18:13912289-13912311 TCTTATCTATAATATAGGCAGGG - Intronic
1154486689 18:14877618-14877640 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1155210648 18:23597821-23597843 CCTCAACTGTAAGATGGGGATGG + Intergenic
1155337826 18:24783427-24783449 TCTCATCCGTAAAATAGAGATGG - Intergenic
1155346278 18:24860264-24860286 CAGCATCTGTAAAATGGGGATGG + Intergenic
1155517054 18:26634755-26634777 TCTTCTCCGTAAAATAGAGAGGG - Intronic
1155878623 18:31117041-31117063 ACTTATCTGTTCAATGAGGAAGG + Intergenic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1156916423 18:42468044-42468066 TTTTATCTGTAATATGGAGCTGG - Intergenic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157198834 18:45642003-45642025 CCTCATCTGTAAAATGGGCCAGG - Intronic
1157346308 18:46838328-46838350 CCTTATTTATAACATGGGGATGG - Intronic
1157380256 18:47208073-47208095 TCTTATCTATAAAATGTGGATGG - Intergenic
1157562213 18:48656365-48656387 CCCCATCAGTAAAATGGGGATGG + Intronic
1157796766 18:50582043-50582065 TCTCATATGTAAAGTGGAGAGGG + Intronic
1158219819 18:55139109-55139131 TCTCAACTGTAAAATGGGCATGG + Intergenic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158777920 18:60608830-60608852 TATTATTTGTAAAATGGGTGAGG - Intergenic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159442758 18:68502848-68502870 CCTTGTCTGCAAAATGGGGATGG - Intergenic
1159459417 18:68704926-68704948 TTTCATCTATAAAATGGGAAAGG + Intronic
1159863715 18:73680542-73680564 TTTCATCTGTAAAATGAGCATGG - Intergenic
1160848537 19:1178075-1178097 TCCCACCTATAAAATGGGGAGGG + Intronic
1160961120 19:1721354-1721376 CCCTATCTGTAAAATGGAGCTGG - Intergenic
1161261801 19:3341872-3341894 TCCCATCTGTAAAATGGGACAGG + Intergenic
1161418474 19:4161608-4161630 TCTCATCTGCAAAATGGGTTTGG - Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1161631843 19:5360925-5360947 CCCCATCTGTAAAATGGGGCTGG - Intergenic
1162048096 19:8014783-8014805 CCTCATCTCTAAAATGGGGGTGG + Intronic
1162056014 19:8064541-8064563 TTTTCCCTGTAAAATGGGGATGG + Intronic
1162198823 19:9006731-9006753 TCTCATCTATAAAACGGGGATGG + Intergenic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1163087409 19:14992381-14992403 TCTTATCTGTAAAAGGGAGCTGG - Intronic
1163166012 19:15498832-15498854 TCTCAACTGTAAAATGGGAGTGG - Intronic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1163481415 19:17558830-17558852 CCTCATCTGTAACATGGGGGTGG - Intronic
1163551742 19:17969357-17969379 TCCCGTCTGTAAAATGGGAACGG + Intronic
1164148004 19:22524419-22524441 TCACATCTGTAAAATAGGGGTGG - Intronic
1164407506 19:27965164-27965186 TCTTATCTGTAAAATGGTGTTGG + Intergenic
1164690316 19:30206097-30206119 CCTTCTCTATAAAATGGGGATGG - Intergenic
1165043674 19:33087079-33087101 ACTTATCTGTAAAATAGAAATGG - Intronic
1165313933 19:35043507-35043529 TCTCATCTGTGAAATGGAGAGGG + Intronic
1165729686 19:38137031-38137053 CCTAATCTGTAATATGGGGCTGG - Intronic
1165925450 19:39323348-39323370 CCTTATCCATAAAATGGGGATGG - Intergenic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166108454 19:40609128-40609150 TCTCATTGGTAAAATGGGGATGG + Intronic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166371766 19:42305753-42305775 TCTGACCTGTAAAATTGGGTTGG - Intronic
1166516880 19:43453843-43453865 TCTCATCTATAAAATGGCAATGG - Intergenic
1166545244 19:43630585-43630607 TCTCACCTATAAAATGGGAATGG - Intronic
1166625868 19:44355639-44355661 GCTTATCTTTAAAATGGGAATGG + Intronic
1166643254 19:44512366-44512388 TCGTCTCTATAAAATGGGGCTGG + Intronic
1166730544 19:45056844-45056866 GCTTCCCTGTAAAATGGGGCTGG + Intronic
1167006891 19:46782159-46782181 CCTCATCTATAAAATGGGAACGG - Intronic
1167061038 19:47146632-47146654 TCCCATCTGTAAAACAGGGATGG - Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167688867 19:50973164-50973186 TCTTATCTGTAAAATGGGAGTGG - Intergenic
1168243390 19:55098242-55098264 CCTTATCTGTCAAATGGGAATGG - Intronic
1168345162 19:55647098-55647120 GTTAATCTGTAAAGTGGGGAGGG + Intronic
1168387779 19:55980211-55980233 GCTAATCTATAAAATTGGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925839613 2:7979321-7979343 TCTTGTCTGTAAAATAGGAATGG + Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926297538 2:11579561-11579583 TCTCATCTAGAAAATGGGGGTGG - Intronic
926347250 2:11958742-11958764 ACTTATATGAAAAATGAGGAGGG + Intergenic
926363540 2:12112627-12112649 TCGCATTTGTAAAGTGGGGATGG + Intergenic
926448862 2:12977589-12977611 ACTTATATGTAAAATGAGGTTGG - Intergenic
926506856 2:13726823-13726845 TCTTATCTTAGAAATGGTGAAGG + Intergenic
926725992 2:15998412-15998434 CCTCAACTGTAAAATGGAGATGG - Intergenic
926747038 2:16167372-16167394 TGTCAGCTATAAAATGGGGATGG + Intergenic
926855160 2:17248015-17248037 CCTTGTCTGTAAGATGGAGATGG + Intergenic
926886203 2:17601210-17601232 CCTTATTTGTAAAATGGGGGAGG - Intronic
926908710 2:17829685-17829707 TTCCATCTGTAAAATGGAGATGG - Intergenic
926920650 2:17936837-17936859 CCTCATCTATAAAATGGGAATGG - Intronic
926928406 2:18011770-18011792 CCTCTTCTGTGAAATGGGGATGG + Intronic
926937076 2:18096702-18096724 TCTTATCTGCAAACTGGTGCTGG + Intronic
927088664 2:19694095-19694117 CCTCATCTATAAAATGGGCAGGG + Intergenic
927095276 2:19743625-19743647 TCTGCTCTGTAGAATGGAGATGG - Intergenic
927154723 2:20214946-20214968 TCTCATCTGTAAAATGTGCATGG - Intronic
927436825 2:23073711-23073733 TCCTCACTGTAAAGTGGGGAAGG + Intergenic
927503913 2:23601013-23601035 TCTTCTCTATAAAACGGGAATGG - Intronic
927653732 2:24928394-24928416 TTTCATCTGTAAAATGGATATGG - Intergenic
927893732 2:26768287-26768309 TCTCATCTGTAAAATGGACTTGG + Intronic
928216691 2:29367411-29367433 GCTAATCTGTAAAATGAGGGAGG + Intronic
928253972 2:29706118-29706140 CCTCATCTGTAAAATGGAGTGGG + Intronic
928409791 2:31046116-31046138 TTTTATATGTAAAATGTGGATGG - Intronic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
928855283 2:35796042-35796064 TCTTATATGTAATTTGGGGGAGG + Intergenic
928938024 2:36700869-36700891 TTTCATCTGTATAATGGTGATGG - Intronic
929284194 2:40116988-40117010 CCTAATCTGTTAAATGGGGATGG + Intronic
929420250 2:41783044-41783066 CCTTTTCTATAAAATGAGGAGGG - Intergenic
929670524 2:43873674-43873696 TCTCCTATGCAAAATGGGGATGG - Intronic
929954104 2:46442484-46442506 GCTCATGTGTAAACTGGGGATGG + Intronic
930670059 2:54139299-54139321 ACTTAACTGTAAAAAGGAGATGG - Intronic
930729179 2:54710692-54710714 ACTTATCTTTAAAATAGGCATGG - Intergenic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931218496 2:60267696-60267718 GCGCATCTGTAAAATGGGAATGG + Intergenic
931461202 2:62451759-62451781 TCTTATCTGGACACTTGGGAGGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931859326 2:66337665-66337687 CCTTATCTGTAATATGAGGAGGG + Intergenic
931914585 2:66939737-66939759 ACTTATGTGCAAAATGTGGAAGG + Intergenic
931989099 2:67771639-67771661 CCTCATCTGTCAAATGGAGATGG - Intergenic
932084356 2:68745168-68745190 TCTCATCTGAAAAATGGGGCCGG + Intronic
932414558 2:71565759-71565781 TATCATCTGTAAAATGAGGGTGG + Intronic
932828219 2:74960460-74960482 TCTGATCTGTAACATGATGAGGG - Intronic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
932909992 2:75796191-75796213 TCTCATCTGTAAAATAGGAATGG - Intergenic
932933682 2:76075834-76075856 TGTTATCTGTAGAATGGTCAGGG + Intergenic
932951981 2:76304582-76304604 CCTTATCTGTAAAATGGTAGTGG - Intergenic
933188013 2:79300464-79300486 TCTTCTCTCTCCAATGGGGAAGG + Intronic
933220446 2:79681461-79681483 TCTTTCCTGTAATATGGGAATGG + Intronic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933876704 2:86627061-86627083 TATTATCTATAAAATGGGATAGG + Intronic
934141943 2:89055231-89055253 GCTTATCTGTAATATGGAGCTGG - Intergenic
934227294 2:90145315-90145337 GCTTATCTGTAATATGGAGCTGG + Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935555661 2:104507215-104507237 CCTCGTCTGTAAAATGGAGATGG - Intergenic
935639687 2:105279097-105279119 TCTTATCTTTAAAAATGAGAGGG - Intronic
936410484 2:112254016-112254038 TCCCATCTGTAAAACGAGGACGG + Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
936834682 2:116694299-116694321 TCTTATCTATGAAAGGGGAAGGG + Intergenic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937342201 2:121098482-121098504 CCCCATCTGTAAAATGGAGATGG + Intergenic
937343285 2:121105518-121105540 TCTCATCTGGGAAATGGGGATGG - Intergenic
937355519 2:121195924-121195946 TCTCATCTGTAAAATGGAACTGG - Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
937605195 2:123792080-123792102 TCTTATCTGTAGAATGCAGATGG - Intergenic
937850227 2:126625794-126625816 TCTTATCTGACACATGGGAAGGG + Intergenic
938615362 2:132992120-132992142 CCTTATCTGTAAAATGGGAAAGG - Intronic
938786129 2:134631533-134631555 TCTCATCTGTAAAGTGGGCCTGG - Intronic
938833893 2:135079827-135079849 TCTCATCTATAAAATGAGGTTGG + Intronic
939055095 2:137355794-137355816 CCTTCTCTGTAAAGTGGGAATGG + Intronic
939154783 2:138511922-138511944 TCTCTTCTGTAAAATGGAAATGG + Intronic
939472033 2:142634775-142634797 TCTTATGTGTAAAAAGTGGCCGG - Intergenic
939474778 2:142673551-142673573 TATTATCAGTCAAATGGTGATGG - Intergenic
940144842 2:150534800-150534822 TCTCATCTATAAAATGGGTAGGG - Intronic
940868518 2:158840103-158840125 TGTTAGCTGGAAAATGGGAAAGG - Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941301225 2:163804377-163804399 TCTTATCTGTGAAATGAATAAGG + Intergenic
941497011 2:166218246-166218268 ACTTACATGTAAAATGGGGTGGG + Intronic
941747873 2:169106331-169106353 TCTCATCTGTATAATGGGGGTGG + Intergenic
941907818 2:170734077-170734099 CCTTATCTGAAAACTGAGGAAGG + Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
942368891 2:175259336-175259358 CCTTACCTGTAAAATGGGAATGG - Intergenic
942873344 2:180762760-180762782 TCTTGTCTATAAAATGGGAATGG + Intergenic
943600521 2:189914794-189914816 TCTCATCTATAAAATGGGGCAGG - Intronic
943984242 2:194599382-194599404 TCTAATATGTAAAATGAAGATGG - Intergenic
944020737 2:195100590-195100612 ATTCATCTGTAAAATGGAGAAGG + Intergenic
944134501 2:196383953-196383975 ACTCATCTGTAAAATGGCAATGG + Intronic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944988996 2:205212947-205212969 CCCCATCTGTAAAATGGCGATGG - Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
945219857 2:207472546-207472568 TCCTATCTTTAAATTTGGGAAGG + Intergenic
945497486 2:210526485-210526507 TCTTATCTGTAAAAGAGAGAAGG + Intronic
945665847 2:212741311-212741333 TCTTATCTGCAACATGAGGAAGG - Intergenic
945733991 2:213575142-213575164 TCTTATCTGTAAAGTGAGTGAGG + Intronic
945884066 2:215355927-215355949 ATTCTTCTGTAAAATGGGGATGG + Intergenic
945949708 2:216027162-216027184 TCTTATTGGTAAAATGTGAACGG + Intronic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
946413039 2:219525000-219525022 GCTCATCTGTAAAAGGGGAATGG - Intronic
946430184 2:219622070-219622092 TCTTGGCTGGAAGATGGGGAAGG - Intergenic
946541221 2:220686651-220686673 ACTTATCTGTGAAAAGGGAAGGG - Intergenic
947418050 2:229918932-229918954 TTTTATCTGTAAAATGGGAGTGG - Intronic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
947806553 2:232972615-232972637 TTTGATCTGTAAAATGGGTATGG + Intronic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948179015 2:235965601-235965623 TCTAATCTGTAAAGTGGAGGTGG + Intronic
948295023 2:236854213-236854235 CCCTATCCGTAAAATGGGGATGG - Intergenic
948515563 2:238501313-238501335 TCTTATCTTTAAAATTAGAAGGG + Intergenic
1168807581 20:681468-681490 TCTTGTCTGTCAAATGGGAATGG + Intergenic
1168830635 20:843610-843632 TCTCATCTGTAAAATGGAGGGGG - Intronic
1168978548 20:1986176-1986198 CCTCATCTGTAAAGTGGGCATGG - Intronic
1169072554 20:2742249-2742271 TCTCATCCGTAAAGTGGGAATGG + Intronic
1169268079 20:4179746-4179768 CCTCTTCTGTAAAATGGGCATGG + Intronic
1169277927 20:4246022-4246044 TTTTATCTATAAAATAGAGATGG - Intronic
1169689579 20:8315587-8315609 TCTTATGTATAAAATGAGGGAGG + Intronic
1169772010 20:9211237-9211259 TCCTATCTGTAAAATGCAGGCGG - Intronic
1169782768 20:9327035-9327057 TCTCATCTGTAAGGTAGGGATGG + Intronic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1170740625 20:19052937-19052959 TCTCATCCATAAAATGGGGATGG + Intergenic
1170924417 20:20710029-20710051 TTTGCTCTGTAAAATGGGTATGG - Intronic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1171436637 20:25129918-25129940 CCTTGTCTGTAAAATGGAAATGG + Intergenic
1171453101 20:25249637-25249659 TCTTTTTTCTAAAATGGAGATGG + Intronic
1171977509 20:31604927-31604949 TCTCATCTGTGAAATGGAGCTGG + Intergenic
1172049848 20:32109168-32109190 TCCCATCTGTGAAATGGGAAGGG - Intergenic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172126132 20:32626435-32626457 TCTCCTCTGTAAGATGGGGATGG - Intergenic
1172168311 20:32912562-32912584 TCCTCTCTGTAAAATGGACATGG + Intronic
1172282660 20:33719250-33719272 CAATATCTGTAAAATGGGCATGG - Intronic
1172311468 20:33921571-33921593 TCTCGTCTGTAAAATGAGGACGG - Intergenic
1172425251 20:34851521-34851543 TGCTATCTGTGAAATGGGTAGGG + Intronic
1172645686 20:36467886-36467908 CCTTATCTGCAAAACAGGGATGG - Intronic
1172707916 20:36896444-36896466 TTTTCTCTGTACAGTGGGGAGGG - Intronic
1172807644 20:37624116-37624138 TCTCATCTGCAAAATGGGATTGG - Intergenic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1172933366 20:38601475-38601497 CCTCCTCTGTGAAATGGGGATGG - Intergenic
1173153176 20:40585094-40585116 CCCCATCTGTAAAATAGGGATGG + Intergenic
1173153770 20:40590212-40590234 CCTTATTTGAAAAATGGGGAGGG - Intergenic
1173175581 20:40762567-40762589 TCTCATCACTAAAGTGGGGAAGG - Intergenic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173425792 20:42942317-42942339 TCTTCTCTGGAAACTGCGGATGG - Intronic
1173547065 20:43905965-43905987 CCTGACCTGTAAACTGGGGATGG + Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173605135 20:44326566-44326588 TCCCATCTGTTAAATGGGGATGG - Intergenic
1173616357 20:44405867-44405889 TCACATCTGTAAACTGGGGCTGG - Intronic
1173664176 20:44753384-44753406 CCTTGTCTGTAAAATGGAAATGG + Intronic
1173702585 20:45086018-45086040 TCTGATCTGTAAAATGGGGCTGG + Intergenic
1173727341 20:45307012-45307034 TCCTATTTGTATAGTGGGGAGGG - Intronic
1173852985 20:46230487-46230509 CCTCAGCTGTGAAATGGGGATGG - Intronic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1173912404 20:46680022-46680044 CCCCATCTGTAAAATGGGTATGG + Intronic
1173929564 20:46807484-46807506 TCTCAACTGTAAAATGGGGGTGG - Intergenic
1173950386 20:46988348-46988370 TCTCATCTGGAAAATGGTCACGG - Intronic
1173958621 20:47053979-47054001 CCCCATTTGTAAAATGGGGATGG + Intronic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174187728 20:48719078-48719100 TCCCATCTGTAAAATGGGCATGG - Intronic
1174292842 20:49521204-49521226 ACTCATCTGTAAAATGGAGATGG - Intronic
1174357980 20:50010677-50010699 TCTCATCTGTCAAGTGCGGATGG + Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174684531 20:52441023-52441045 CCTAATCTGTAAAGTGGGGACGG - Intergenic
1174911515 20:54612915-54612937 TCTCCTTTGTAAAATGGGAAGGG + Intronic
1174959281 20:55136750-55136772 TGTTAGCTTTAAAATGGAGATGG + Intergenic
1175019405 20:55828337-55828359 CCTAATCTGCAACATGGGGATGG + Intergenic
1175177934 20:57124690-57124712 CGTTATCTATAAAATGAGGAAGG + Intergenic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175359796 20:58400036-58400058 TCTCATCTCTAAAATGGAGATGG - Intronic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175550085 20:59811852-59811874 CCTTGTTTGTGAAATGGGGATGG + Intronic
1175659818 20:60803151-60803173 TCCTATATATAAAATGGGCATGG + Intergenic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1176014449 20:62922593-62922615 TCCTGTCTGTGAAATGGGGACGG + Intronic
1176794613 21:13361781-13361803 TCTCATCTGTTCAGTGGGGATGG + Intergenic
1177152365 21:17468122-17468144 GCATATCTGTAAAATGAAGAGGG - Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1177655414 21:24010870-24010892 TCTTATTTGACAAATGTGGAAGG + Intergenic
1177665394 21:24150476-24150498 TCTTATAAGCAAAATGGTGATGG - Intergenic
1178087696 21:29128749-29128771 GCTCATCTGTCAAATCGGGATGG + Intronic
1178161247 21:29918373-29918395 TCTTGTCTGTAAAATGAGATTGG - Intronic
1178248696 21:30979789-30979811 CCTTATCTGTAAAATGGGCATGG + Intergenic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178412819 21:32379664-32379686 TCTCATCTGTAAAATGGGTGTGG - Intronic
1178681156 21:34672809-34672831 TCTCATTGATAAAATGGGGACGG + Intronic
1178701625 21:34838392-34838414 TCTTAGCAGAAAAATGAGGAAGG + Intronic
1179009715 21:37546851-37546873 TCCTATCTATAAAACGGGAATGG - Intergenic
1179593578 21:42427569-42427591 TCAGATCTGTAAAATGGGTAGGG - Intronic
1180487336 22:15815082-15815104 CCTTATTTCTAAAATAGGGAAGG - Intergenic
1180742123 22:18061117-18061139 TCTGATCTGGAAAAGGGGCAGGG + Intergenic
1180826102 22:18862935-18862957 TTTCATCTATAAAATGGGCATGG + Intergenic
1181186630 22:21111616-21111638 TTTCATCTATAAAATGGGCATGG - Intergenic
1181212570 22:21298878-21298900 TTTCATCTATAAAATGGGCATGG + Intergenic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181723142 22:24791529-24791551 TCCCATCTGTAAAATGGGATGGG - Intergenic
1181762825 22:25069639-25069661 TCCTCTCTGTAAAATGGGGATGG + Intronic
1181907041 22:26206474-26206496 CCTTATTTTCAAAATGGGGATGG - Intronic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1181997758 22:26896240-26896262 TCTCATGTGTAAAATGGGAATGG - Intergenic
1182044779 22:27265741-27265763 ACTCATCTTTAAAATGGAGATGG - Intergenic
1182047309 22:27285413-27285435 CCTCATCTATAAAATGGGAAGGG - Intergenic
1182052093 22:27321140-27321162 CCTCATCTGTAAAATGGAAATGG + Intergenic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182117013 22:27762321-27762343 CCTCATCTATGAAATGGGGATGG + Intronic
1182131039 22:27850864-27850886 TCTCATCTATACAATGAGGATGG + Intergenic
1182151281 22:28028872-28028894 CGTCATCTGTGAAATGGGGATGG - Intronic
1182168164 22:28197523-28197545 CTTCATCTCTAAAATGGGGAAGG + Intronic
1182264861 22:29106550-29106572 TCTTATCTGAGAAATGGAGGCGG - Intronic
1182318754 22:29464777-29464799 TCTCATCTGTGAAATGGGTGGGG - Intergenic
1182580173 22:31303622-31303644 CTTTATCTGTAAAATGGATAGGG + Intergenic
1182709127 22:32309762-32309784 TCTTATCTGTCAAATGTGTGAGG - Intergenic
1182745554 22:32603196-32603218 TGTTATCTATAACATGGGGGAGG - Intronic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182882262 22:33743725-33743747 CATCATCTGTAAAATGGGGGTGG - Intronic
1182893251 22:33836753-33836775 TTTTATCTGTAAAATAGGGATGG + Intronic
1183003777 22:34883264-34883286 CCTTATCTGTAAGATGTAGAAGG + Intergenic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
1183346497 22:37311187-37311209 CCCCATCTGTAAAATGGGCATGG - Intronic
1183414761 22:37675854-37675876 CCACATCTGTAAAATGGGGGTGG + Intronic
1183622664 22:38983562-38983584 TCTCCTCTGTAAGATGGGAATGG + Intronic
1183630291 22:39028431-39028453 CCTCCTCTGTAAAATAGGGATGG + Intronic
1183687829 22:39371890-39371912 TCTTATCTGCAAAATGCTGATGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184341445 22:43888213-43888235 CCTTATCTAGAAAATGGGGCTGG + Intronic
1184402217 22:44280778-44280800 CCCTATCTGTAAACTGGGCAGGG - Intronic
1184424744 22:44402886-44402908 TCTCATCTGCACAGTGGGGATGG + Intergenic
1184549098 22:45194924-45194946 TCTCGTCTGTAAGATGGGGTCGG + Intronic
1184565052 22:45286858-45286880 TCTCTTGTGTAAAATGGGAAAGG - Intronic
1184697079 22:46145776-46145798 CCTCATCTCTAAAATGGGGCAGG - Intergenic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
1203276244 22_KI270734v1_random:88841-88863 TTTCATCTATAAAATGGGCATGG + Intergenic
949102973 3:168209-168231 TTTTATCTACAAAATGGTGAAGG - Intergenic
949239128 3:1849083-1849105 ACTTATCTATAAAATGGGAGTGG - Intergenic
949319293 3:2790880-2790902 TCATGTCTGCAAAATGGTGATGG - Intronic
949409385 3:3747386-3747408 TCTCATCTGTCAAATAAGGAGGG + Intronic
949484507 3:4524873-4524895 TCTCACCTGTAAAATGGGAGAGG + Intronic
949497330 3:4644844-4644866 CCTTATCTCTGAAATGGGGGCGG + Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949866451 3:8551451-8551473 TCTCACCTGTAAAATGGGTTTGG - Intronic
950016055 3:9755922-9755944 TCTTGTCTGTAAAGTGGGTGTGG + Intronic
950106629 3:10392810-10392832 TGTCATCTGTAGAGTGGGGAGGG + Intronic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950222143 3:11204721-11204743 TCTCATTTGTAAATTGGAGATGG - Intronic
950228576 3:11256322-11256344 TCTCATGTGTCAAATGGGTAGGG - Intronic
950240432 3:11365109-11365131 TCTTATCTGTAACATAGAGAAGG + Intronic
950265511 3:11570115-11570137 TCTCTTCTGTAAAACTGGGATGG - Intronic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950397235 3:12742871-12742893 CCTTATCTGTATAATGGGTGGGG - Intronic
950398491 3:12752454-12752476 TCTGACCTATAAAATGGGCACGG - Intronic
950454786 3:13086210-13086232 TCCTATATGGAAAATGGGAAAGG + Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950650636 3:14404506-14404528 CCTTACCTGTAAAATGGGTGGGG + Intronic
950654971 3:14430919-14430941 CCTCATCTGTAAAATGGGCTTGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950684491 3:14606744-14606766 TGTTATCTGTGAAATAGGGATGG + Intergenic
950711022 3:14812764-14812786 CTTTATCTGAAAAATGGGGTTGG + Intergenic
950711034 3:14812968-14812990 TCCCATCTATAAAATGGGGATGG - Intergenic
950771016 3:15311253-15311275 TCTTATCTGTAAACTCGGGATGG - Intronic
950987936 3:17395964-17395986 TCTTAAGTGTCAAATGAGGAAGG + Intronic
951214264 3:20008822-20008844 TCTTATCTGTAAAATGCACAAGG + Intronic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951378536 3:21954092-21954114 TCTTATCTTCCAAATGGGGATGG - Intronic
951463610 3:22977700-22977722 CTTTATCTGTACAATGAGGACGG + Intergenic
951600803 3:24372701-24372723 TCCTGTCTGTAAAATGGGGATGG - Intronic
951762151 3:26159344-26159366 GCTTATCTGTAATATGGAGCTGG + Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952257753 3:31710179-31710201 TCCTGTCTCTAAAATGGAGATGG + Intronic
952474465 3:33692608-33692630 CCTTGTCTGTAAAATACGGAAGG + Intronic
952518523 3:34130409-34130431 TCTTATTTGTGAACTTGGGAGGG + Intergenic
952654865 3:35773328-35773350 CATCATCTGTAAAATAGGGAAGG - Intronic
952966055 3:38621975-38621997 TCTCATCTGTGCAATGGGGAAGG + Intronic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953355685 3:42254611-42254633 TATTATTTGTAAAATGGGAGTGG + Intergenic
953741839 3:45545121-45545143 CCCTATCTGTAAAATGGGATGGG + Intronic
954446302 3:50548721-50548743 CTTCATCTGTAAAATGGGGCAGG - Intergenic
954619839 3:51989243-51989265 CCTCATCTGTGAAATGGAGATGG - Intergenic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
955071129 3:55573261-55573283 CCTCATCAGTAAAATGGGTATGG + Intronic
955133919 3:56197249-56197271 CAGTATCTGTAAAATGGGAATGG + Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955210994 3:56940874-56940896 TCTTATCTGCAAAATAGGTATGG - Intronic
955259809 3:57376085-57376107 GCTTATCTGTAAAATGAGGTTGG + Intronic
955432923 3:58868548-58868570 TCTCCTCTGTAAAATGGGAATGG - Intronic
955708531 3:61754264-61754286 GCTCAGCTGTAAAATGGAGATGG + Intronic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
955867801 3:63403545-63403567 TCTCATCTGTTAAATGAGGATGG - Intronic
955959815 3:64328711-64328733 TGTTATCTGTAAAATGGGAAGGG - Intronic
956093481 3:65692562-65692584 CCTTATCTACAAAATGGGGATGG - Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956343255 3:68249550-68249572 TGTTATCAGTAAAAGGGGAATGG + Intronic
956482275 3:69685146-69685168 CCATATCTGTAAAATGGGAATGG + Intergenic
956499590 3:69868266-69868288 TCTCAGCTGCAAAATGGGGGTGG - Intronic
956542742 3:70361028-70361050 TCTTATCTGTAATACAGGGATGG - Intergenic
956699067 3:71942787-71942809 TCTCATGTGTGAAATGTGGATGG + Intergenic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956882597 3:73526371-73526393 CCTTATCTGTGGAATGGGTATGG - Intronic
956971680 3:74533550-74533572 TTTCATCTGTAACATGGGGGTGG - Intergenic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957040273 3:75330877-75330899 CCTTATCTTTAAATTGGGCATGG - Intergenic
957194228 3:77047314-77047336 CCTTACCTGTAAAATGGGCATGG + Intronic
957340203 3:78885837-78885859 CTTCATCTGTAAAATGGGCAGGG - Intronic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
957569180 3:81924488-81924510 TCTTATCTACAAATTGGGGAGGG - Intergenic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
958455433 3:94325344-94325366 TCTCACCTGCAAAATGGAGATGG + Intergenic
958778670 3:98515292-98515314 TCTTATTTCTAATAGGGGGAAGG + Intronic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
958974287 3:100648744-100648766 TCTTATTTGTAAAATATGAAAGG - Intronic
959164272 3:102757763-102757785 TATTTTCTGTAAAAAGGAGAGGG - Intergenic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959400703 3:105898621-105898643 AATTATCTTTAAAGTGGGGAAGG + Intergenic
959537846 3:107507296-107507318 TCTCATCTGTAAATTGGGAGTGG - Intergenic
959730563 3:109596719-109596741 TCTTATCCATAATATGGGGATGG + Intergenic
959783932 3:110270321-110270343 TCCTATCCATAAAATGGGTATGG + Intergenic
960574498 3:119216861-119216883 CCTCATCTGTAAAATGGCAATGG + Intronic
960789597 3:121413870-121413892 TCTTATTTGTAAAATGAGGGGGG - Intronic
960997238 3:123348281-123348303 GCTCGTCTGTAAAATGAGGATGG + Intronic
961045068 3:123702457-123702479 CCTTATCTTTAAATTGGGCATGG - Intronic
961190019 3:124952197-124952219 TCTTATCTGTAAAATAGGACTGG + Intronic
961203794 3:125065048-125065070 TCTTATCTGTAAAATATGAACGG + Intergenic
961335886 3:126179618-126179640 TCTTGTCTCTAAAATCGGGAGGG - Intronic
961535496 3:127568137-127568159 CCTCATCTGTAAAATGGGATAGG + Intergenic
961816059 3:129550982-129551004 TCTTATCTGTAAGATGGGGATGG - Intronic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
961931379 3:130537284-130537306 TCTCATCTGTAAAGTGGGTCTGG + Intergenic
962070359 3:132027329-132027351 TCTTATCTGGAAAATGGGAGGGG + Intronic
962786147 3:138769871-138769893 TCTTATCTTTAAAATGGGTAGGG - Intronic
962869666 3:139477014-139477036 TCTCATCTGTAAAATAAGGATGG - Intronic
963059045 3:141210019-141210041 GCTTATCTGTAATATGGAGCTGG - Intergenic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
963320417 3:143804180-143804202 GCTTATCTGTAATATGGAGCTGG - Intronic
963896108 3:150686690-150686712 TTCTATCTGTAAAATTGTGAAGG - Intronic
964374144 3:156033104-156033126 ATTTATCAGAAAAATGGGGAGGG - Intergenic
964687368 3:159412112-159412134 TCTCAGCTGTAAACTGGGTATGG - Intronic
964742502 3:159982457-159982479 TCATATCAGCAAAATGGAGATGG - Intergenic
964775778 3:160275062-160275084 CCTCATTTGTAAAATGGGGCTGG + Intronic
965400458 3:168206818-168206840 TCTCATCTTTAAGATGGGAATGG + Intergenic
965507714 3:169534755-169534777 CCTCCTCTGTAAAATAGGGATGG - Intronic
965603108 3:170473858-170473880 TCTCATCTGCAAAACGGGGTTGG + Intronic
965638721 3:170811081-170811103 CCTTATCTGTAAAATGGAGGTGG + Intronic
965727979 3:171739702-171739724 CCTTATCTATAAAGAGGGGATGG - Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
965772600 3:172196577-172196599 TCTCATCTGTAAAATGGAGGTGG + Intronic
966167987 3:177042705-177042727 TCTTATGTGTAAAATGAGATGGG - Intronic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
966833132 3:184028194-184028216 CCTTATCTCTAAAATTGGGAGGG - Intergenic
967297012 3:187975130-187975152 CCTTTTCTGTAAAATGGGTGGGG - Intergenic
967834369 3:193948549-193948571 TCTCATCTGGAAAATGGCAATGG + Intergenic
967925005 3:194639119-194639141 TCCTTTCTGTAAAAGGAGGAAGG + Intergenic
968018958 3:195366726-195366748 TCTTCTCAGTAAAATGGTGTTGG - Intronic
968283925 3:197497128-197497150 TCTCATCTGTAAAAGAGGGGAGG + Intergenic
968996037 4:3946468-3946490 TCTCATCTATAAAATGGAGGTGG - Intergenic
969148926 4:5151781-5151803 TCTCATCTGTAAAATGGAAAGGG + Intronic
969241909 4:5904528-5904550 CCTTATCTGTAAAATGGGTGTGG - Intronic
969319342 4:6402422-6402444 TCTCACCTGCAAAATGGGCATGG + Intronic
969350160 4:6593656-6593678 CCTCCGCTGTAAAATGGGGATGG + Intronic
969364360 4:6685622-6685644 TCTCATCTGTAAAATGGATGGGG - Intergenic
969478234 4:7433234-7433256 TTTCATTTGTGAAATGGGGATGG + Exonic
969520618 4:7675825-7675847 CCCCATCTCTAAAATGGGGATGG - Intronic
969814247 4:9674902-9674924 CCTTGTCTGTAACTTGGGGATGG - Intergenic
969943364 4:10757475-10757497 TCTCATCTATAAAATAGGAATGG + Intergenic
969976723 4:11110261-11110283 TTTTATTTTAAAAATGGGGATGG + Intergenic
970006051 4:11411933-11411955 TCCCATCTGAAATATGGGGATGG + Intronic
970359612 4:15295726-15295748 TCAGATCTGTAAAATGGGAATGG + Intergenic
970383482 4:15532030-15532052 TCACATCTGTAAAATGGGTATGG - Intronic
970560355 4:17276170-17276192 CCTCGTCTGTAAAATGGGAAGGG + Intergenic
970600139 4:17635515-17635537 TATTATAGGTAAAGTGGGGATGG - Intronic
970974641 4:22029427-22029449 TCTACTCTGTAACATGGGCATGG - Intergenic
971181688 4:24334272-24334294 TCTCATCTATAAAATGGGAAAGG - Intergenic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
971493840 4:27242821-27242843 CCCAAGCTGTAAAATGGGGAGGG + Intergenic
972347604 4:38205951-38205973 TCTTATCTCTTGAATAGGGAGGG - Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972689874 4:41386377-41386399 TCTTATCTATGAAATGGTTATGG + Intronic
972724144 4:41731522-41731544 TCTCATCTGTGAAATGAGGATGG + Intergenic
973148477 4:46859460-46859482 TCTCATCTGGAAAATGGTGCTGG + Intronic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
973786731 4:54339431-54339453 TCTCATCTTTCACATGGGGATGG - Intergenic
973917748 4:55653558-55653580 TCTCATCTATAAAATGTGTATGG - Intergenic
973991200 4:56409170-56409192 GTTTATCTGTAAAATGGGCATGG - Intronic
974021963 4:56699488-56699510 TCTCATCTCTAAAATGAGCATGG - Intergenic
974407543 4:61495056-61495078 TTTTATCTGTGTAATGGGTAGGG - Intronic
975464490 4:74694078-74694100 GCTTATCTATTAAATCGGGAAGG - Intergenic
975512785 4:75211783-75211805 TCTCCTCTGTAAAATGGAAAAGG + Intergenic
975654923 4:76632014-76632036 TTTTATCTGAATAATTGGGATGG + Intronic
975780320 4:77832342-77832364 TATTATCAGTAAAATGGAGTTGG + Intergenic
975824939 4:78309486-78309508 TCCTATCTGGAAAATGAGAATGG - Intronic
975997422 4:80332356-80332378 GCTTATTTTTAAAATGGGAAAGG + Intronic
976147865 4:82060378-82060400 TCTCATCTGTGAAATGTGGCAGG - Intergenic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976338273 4:83916126-83916148 GAGTATCTGTAAAGTGGGGATGG + Intergenic
976614536 4:87063041-87063063 TCTTTTCTGTAAAATAGCAATGG + Intronic
977415705 4:96730294-96730316 TCTTATCTGCCACATGAGGAAGG - Intergenic
977544751 4:98364336-98364358 TTTTATCTGTAAAATTTGGCAGG - Intronic
977570496 4:98624185-98624207 TTTTGTCTGTAAAACAGGGATGG - Intronic
977860875 4:101958275-101958297 AAATATCTATAAAATGGGGATGG - Intronic
978142634 4:105335029-105335051 TCTCATCTGTACAATGATGAAGG + Intergenic
978475976 4:109130537-109130559 TTTTATCAGTAAAAAGGGGAAGG + Intronic
978737603 4:112101815-112101837 TCTTTTTTGTAAAGAGGGGAAGG + Intergenic
978840928 4:113210632-113210654 GCTTATCTGTAAAACAGGTAAGG + Intronic
978912860 4:114085041-114085063 TCTTATCAGTAAAATAGGGGTGG - Intergenic
979135700 4:117110702-117110724 TCTATTCTGAAAAATGGGCATGG + Intergenic
979353218 4:119670423-119670445 CCTTGTCTGTAAAATGAGAATGG + Intergenic
979465250 4:121029940-121029962 TCTCATTTGTAAAATGAGAAGGG - Intergenic
979973216 4:127163537-127163559 CCTCATTTGTAAATTGGGGAAGG - Intergenic
980074019 4:128274909-128274931 TTTTATCTGCCAAATGGGGAAGG - Intronic
981316314 4:143343137-143343159 CCTTACCTGTAAAATGGGGGAGG + Intronic
981411104 4:144433723-144433745 TCTTATCTGTAAAATGGGAATGG - Intergenic
981576241 4:146208738-146208760 TCTCATCTGTAAAGTGGAAATGG + Intergenic
981780661 4:148425879-148425901 TCATATCTGTAAAATAGTGACGG + Intronic
982342062 4:154310622-154310644 TGTTTTCTGTAGACTGGGGATGG + Intronic
983068356 4:163238151-163238173 TATTTTCTGTAAAATGGTAATGG + Intergenic
983160260 4:164404688-164404710 TCTAATATGTAAAATGAAGATGG - Intergenic
983163105 4:164441609-164441631 TCTCATCTCTAAAACTGGGAGGG + Intergenic
983335540 4:166387171-166387193 TCTTCTATGCAAAATGGGGTTGG + Intergenic
984484552 4:180351924-180351946 TCTGATGTCTAAAATGGAGATGG - Intergenic
984936617 4:184895374-184895396 TCTTTTTTGTAGGATGGGGAGGG + Intergenic
985139572 4:186825337-186825359 TCTCATCTGCAAAATGGGAGTGG + Intergenic
985821381 5:2163195-2163217 TCTCATCTCTAACATGGGGATGG + Intergenic
986172183 5:5324105-5324127 TCTGCTCTGTAAAATGGGATTGG - Intergenic
986393347 5:7304865-7304887 TCACATCTGTAAAATAGGGGTGG - Intergenic
987037956 5:14036851-14036873 TTTTACCAGGAAAATGGGGAGGG - Intergenic
987072776 5:14353593-14353615 TCTCATCTATAAAATGGGCATGG - Intronic
987227614 5:15859833-15859855 CTTTATCTGTAAAATGGGTCAGG - Intronic
987756635 5:22105387-22105409 TCTTATTTGAAAAATGAGGCTGG - Intronic
988297598 5:29385974-29385996 TCTCATCTGTTAAATGGCAAGGG + Intergenic
988704734 5:33713940-33713962 TCTTATCTGTAAAAGAAGGTTGG - Intronic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
989151377 5:38303050-38303072 TCTTCTCTATGAAATGGGAATGG - Intronic
989288460 5:39732201-39732223 TTTTATCTATAAAAAGGGAATGG + Intergenic
989344393 5:40412772-40412794 TCCCATGTGTAAAATGGGAAAGG + Intergenic
989622831 5:43401550-43401572 TTTTTTCTGTAATATGGGGGTGG + Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990626014 5:57612351-57612373 TCTAATTTGTAAAATGGGAAGGG - Intergenic
991006850 5:61836434-61836456 TCTCATCTTTAAAATGAGAAAGG + Intergenic
991086738 5:62654576-62654598 CCTCCTCTGTAAAATGGAGATGG + Intergenic
991439543 5:66632448-66632470 TCCTAGCTGTGAAATGGGAATGG + Intronic
991490188 5:67175163-67175185 TCTCATCTATAAAATGGGAATGG - Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
991950506 5:71943015-71943037 TCTTATCTGTAAAATGCATAGGG - Intergenic
992173486 5:74126971-74126993 TAATATCTATAAAATGGGGTAGG - Intergenic
992197991 5:74358349-74358371 CCTTATCTGTAATGTGGGAATGG + Intergenic
992244190 5:74801352-74801374 CCTTAGCTATAAAATAGGGATGG - Intronic
992673540 5:79083072-79083094 TCTTATCTGTAAATTGTGGGAGG + Intronic
992918377 5:81483536-81483558 TCTTACCTGTAAAATAGGAGTGG - Intronic
993050174 5:82917308-82917330 TCTTATTTGTTAAATGGAGATGG + Intergenic
993336367 5:86664624-86664646 GCTTATCTGTAAAATGGAAGAGG + Intergenic
993520595 5:88894954-88894976 CCCTTTTTGTAAAATGGGGAAGG + Intronic
993526904 5:88976157-88976179 TGTTACCTGTAAAAGGGGCATGG + Intergenic
993693017 5:91026040-91026062 TCTCATTTTTAAAATGGGGATGG - Intronic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
993822591 5:92637707-92637729 TCTTTTCTATAAAATGGGATAGG + Intergenic
994003061 5:94804315-94804337 TCTTACCTATAAAATGGAGATGG + Intronic
994022066 5:95038660-95038682 TTTCATCTGTGAAATGGGGGAGG - Intronic
994294828 5:98078387-98078409 CCTTATTTGTAAAATGGAGATGG - Intergenic
995035381 5:107528134-107528156 TGTCATCTGCAAAATGGGAATGG + Intronic
995269267 5:110202930-110202952 TTTTATCTCTAAAATGTAGATGG + Intergenic
995441146 5:112193599-112193621 TCTCTTCTGAAAAATGAGGAAGG - Intronic
995441929 5:112201916-112201938 TCTCATCTGTAAAACTGAGATGG + Intronic
995648264 5:114338485-114338507 TTTTATCTATAAAGTGAGGATGG - Intergenic
996155139 5:120090166-120090188 TCTCACCTGTAAAATGTGGTAGG + Intergenic
996347043 5:122498833-122498855 TCCCACTTGTAAAATGGGGATGG - Intergenic
996531034 5:124527201-124527223 TCTTATGTGTAAAAATGGAATGG - Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
996864161 5:128100320-128100342 CCTTATATGAAAAATGGGAAAGG + Intronic
997025765 5:130059104-130059126 TATCTTCTGTAAAATGTGGATGG + Intronic
997079590 5:130722765-130722787 TCTTACCAGTAAATGGGGGAAGG + Intergenic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
997423425 5:133786898-133786920 TCTTATCTGTGAAATGAGAATGG - Intergenic
997880213 5:137582615-137582637 TCTCATCTATAAAATGGGAATGG - Intronic
998377691 5:141702168-141702190 TCTTAGCTGTAAAATGGGCACGG + Intergenic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
998593226 5:143499967-143499989 TCTTATCTGTCATATGGGGGTGG + Intergenic
998796325 5:145823540-145823562 CCGTATCTGAAAGATGGGGATGG - Intronic
998895503 5:146795109-146795131 CTTTATCTATAAAATGGGGCTGG + Intronic
998928008 5:147148542-147148564 TCTCAAGTATAAAATGGGGATGG + Intergenic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999271671 5:150300270-150300292 TATCATCTGTAGAATGGGGGTGG - Intronic
999276133 5:150331287-150331309 TCTTATCTGTAAACAGAGTAGGG - Intronic
999343643 5:150795803-150795825 CCTTATCTTTCAAATGGGGATGG + Exonic
999363170 5:151003288-151003310 TCTTCTCTGTAAAAAAGGGTAGG - Intergenic
999471522 5:151859030-151859052 TCTAATCTGAAAAATGGGCCTGG + Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
999996231 5:157095035-157095057 CCTTCACTGTAAAATGGGGATGG + Intronic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1000186041 5:158859077-158859099 TCTTGTATGGAAAATGGAGAGGG - Intronic
1000278864 5:159764750-159764772 TCCTATCAATCAAATGGGGATGG - Intergenic
1000281529 5:159786561-159786583 TCCCACCTGTAAAATGGGAATGG + Intergenic
1000414401 5:160968084-160968106 TCTTATCTGTCAAATGTGGGTGG + Intergenic
1000961777 5:167609205-167609227 TGTTATCTGTACAATGGGTATGG - Intronic
1001019115 5:168167810-168167832 TCTTATCTGTAAAATAGGCATGG + Intronic
1001107714 5:168869377-168869399 TATCATCTGTAAACTGGTGATGG + Intronic
1001109336 5:168882948-168882970 CATCTTCTGTAAAATGGGGATGG - Intronic
1001165816 5:169365890-169365912 TCTCATTTGAGAAATGGGGAGGG - Intergenic
1001301674 5:170538081-170538103 TCTCATCTTTAAAATGGGAAAGG - Intronic
1001320104 5:170673832-170673854 TTTAATCTGTAAAATGGTGGTGG + Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001529457 5:172452159-172452181 TTTCATCTGTGTAATGGGGATGG - Intronic
1001591426 5:172867920-172867942 ACTCATCAGTAAAATGGGGAGGG - Intronic
1001699117 5:173694054-173694076 CCTCCTCTCTAAAATGGGGATGG - Intergenic
1001728012 5:173924119-173924141 ACTTATCTGTAAGATGGGAGAGG - Intronic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1001775750 5:174327960-174327982 CCTTATCTGTAAAAATGGGACGG + Intergenic
1001780341 5:174363291-174363313 CCTTCTCTATAAAATGGGGGTGG + Intergenic
1001874159 5:175184985-175185007 CATTATCTGTGAAATGGGGATGG - Intergenic
1002026498 5:176399443-176399465 TCTCATTTGAAAAATGGGGCTGG + Intronic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002093616 5:176818284-176818306 CCTCATCTGTAAAACGGGAATGG - Intronic
1002460570 5:179371510-179371532 TTTCATCTGTAACATGAGGATGG - Intergenic
1002603899 5:180370726-180370748 CCTCATCTGTAAAACGGGGCTGG + Intergenic
1003205247 6:4003396-4003418 TCTTAACTATAAAATGAAGAAGG - Intergenic
1003238418 6:4319437-4319459 TCTTCTCTTTCAAATGAGGAAGG - Intergenic
1003249815 6:4416437-4416459 TCTTACTTGTAAAGTGGAGATGG + Intergenic
1003534410 6:6963767-6963789 TCTTATTTTTAAAAAGGGGAGGG - Intergenic
1003849734 6:10209441-10209463 TCTCACCTGTAAAATGGGGCTGG - Intronic
1003970342 6:11293110-11293132 TATTTGCTGTAAAAAGGGGAAGG + Intronic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004900287 6:20187303-20187325 TCTCATCTGTAAAGTGAGGGAGG + Intronic
1005005283 6:21281742-21281764 AGCTATCTGTAAAAGGGGGAGGG - Intergenic
1005663713 6:28027059-28027081 TCTTATCTGTGAAATAGGCATGG - Intergenic
1005945640 6:30593410-30593432 TCTCATCTGTAAAATGAAGGTGG + Intronic
1006135464 6:31893130-31893152 TCTCATCTGTAAAATGGAAAAGG - Intronic
1006387313 6:33738575-33738597 TCTCATCTGTAAAACGGGGCTGG - Intronic
1006445685 6:34078588-34078610 TCCTACCTGTGAAATGGGGTGGG + Intronic
1006590814 6:35155558-35155580 TCTTATATGTAAAATGGTGAAGG - Intergenic
1006601432 6:35229104-35229126 TCTCCTCTCTAAAATGGGGGTGG + Intronic
1006793208 6:36716901-36716923 GCTCATTTGTAAAATGGGGTGGG - Intronic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1006915370 6:37590468-37590490 TGTCATCTAGAAAATGGGGATGG + Intergenic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007403094 6:41615792-41615814 TCTCATCTGTAAAGTGGAGCTGG + Intergenic
1007791679 6:44312664-44312686 CCTCATCTGTAAAATAGGGGCGG - Intronic
1007811463 6:44489157-44489179 GCTCATCTGTGAAATAGGGATGG - Intergenic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008055605 6:46942516-46942538 TCTTATGTGTAAAAGAGAGACGG + Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG + Intronic
1008299572 6:49818561-49818583 CATTATCTGTAAAATGGAGATGG + Intergenic
1008979317 6:57464896-57464918 TCTTATCTGAAAAAGAGGGACGG - Intronic
1009343849 6:62590028-62590050 TCTTGTCTGTAATATGGAGCTGG - Intergenic
1010084998 6:71906753-71906775 TCTTATTTGTGAAATGGGGATGG + Intronic
1010329327 6:74604311-74604333 TCTTATCTGGAAAATGTGTGTGG + Intergenic
1010515713 6:76770681-76770703 TCTTATCTGTAGAAGAGGAAAGG - Intergenic
1010715649 6:79226347-79226369 TCTCATATGTAAAATGAGAACGG + Intronic
1010831098 6:80530519-80530541 TCTCATCTGTAAAATCTGGAAGG - Intergenic
1010952659 6:82055565-82055587 TCTAATCTGTAAAATGGGGTTGG - Intergenic
1011128608 6:84032842-84032864 TCTCATCAGTAAAATGGAAATGG + Intergenic
1011178331 6:84588987-84589009 TATTGTCTGGAAAATGGGGAAGG - Intergenic
1011472111 6:87718260-87718282 CCTTATCTTTGAAATAGGGATGG + Intergenic
1012394820 6:98784470-98784492 TCTTATCTATAAGATGGGGGTGG - Intergenic
1012666658 6:101979429-101979451 ACTTATCTGTTAAAGGTGGAAGG + Intronic
1012860943 6:104558802-104558824 TCCCATCTGTAAAATGAGGCTGG + Intergenic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1012952317 6:105531480-105531502 TCTCATCTATAAAATGGGAATGG - Intergenic
1013139054 6:107312521-107312543 CCCCATCTGTTAAATGGGGATGG + Intronic
1013193852 6:107828088-107828110 CCTTATCTGTAAGATGGGAATGG - Intergenic
1013246399 6:108291265-108291287 TCTTATCTATAAAATTAGGGTGG - Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1013878257 6:114861225-114861247 TATTATCTGTAAAATTAGAAAGG + Intergenic
1014371246 6:120610627-120610649 TCTTTTCTCTAAAATGTTGAAGG - Intergenic
1014631986 6:123799757-123799779 TCTTATTTATAAAATGGGAGGGG - Intergenic
1014832273 6:126116703-126116725 TTTTAACTGTAAAATAAGGATGG + Intergenic
1015025521 6:128527749-128527771 GCTTATTTGAAAAATGGAGAAGG + Intergenic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015267913 6:131307631-131307653 TCTTGTCTGTGGAATAGGGAGGG - Intergenic
1015306535 6:131715293-131715315 GCTTATGTGTAGAATGGAGAAGG - Intronic
1015316309 6:131820697-131820719 TTTCATCTCTAACATGGGGATGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015555434 6:134456473-134456495 TGTTCTCTGCAAAATGGGCAGGG + Intergenic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1015744350 6:136493929-136493951 TCATGTCTGTAAAATGGGGAAGG + Intronic
1015797510 6:137027728-137027750 ACTAAGCTGTAAAATGAGGATGG - Intronic
1016510592 6:144838651-144838673 CTTTATTTGTAAAATGGGGAGGG - Intronic
1016558324 6:145366075-145366097 TCATATCTGGAAAAGGGGGTGGG + Intergenic
1017224548 6:152005678-152005700 TCCTGTCTGTAAAATGCAGATGG - Intronic
1018021783 6:159767935-159767957 CCTTACCTGTAAACTGGGAATGG - Intronic
1018071869 6:160171800-160171822 TCATATTTATAAAATGGGGAGGG + Intronic
1018826100 6:167408850-167408872 TCTTATTAATAAAATGGAGATGG - Intergenic
1018892557 6:167992880-167992902 CCTTTTCTATAAAATGGAGACGG - Intergenic
1018919260 6:168160074-168160096 CCCTATCTATAAAATGAGGAGGG + Intergenic
1018975118 6:168558563-168558585 TCTCATCTTTAAAATGGTAATGG + Intronic
1019294773 7:267907-267929 TCTTATTTATAAAACGGGGTTGG - Intergenic
1019339104 7:500067-500089 TTTCATCTGTCAAATGGGGTGGG + Intronic
1019561405 7:1660510-1660532 TGTCACCTGTAAAAGGGGGAAGG + Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020032609 7:4943466-4943488 TCTCTTCTGTGAAATGGGTAGGG - Intronic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1020363337 7:7353453-7353475 ACATTTCTGTAAAGTGGGGAAGG - Intergenic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1021217919 7:17940239-17940261 GTTTACCTGTGAAATGGGGAAGG - Intronic
1021395484 7:20142975-20142997 ACATTTCTGTAAAAAGGGGATGG + Intronic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021553017 7:21892067-21892089 TCCTCTCTGGGAAATGGGGATGG + Intronic
1021610016 7:22447894-22447916 GCTCATCTGTAAAAAGGAGATGG - Intronic
1021783279 7:24127697-24127719 TCTTATCTGTGAGAAGGTGAAGG - Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022040764 7:26579351-26579373 CCTCATCTGTAAAATGGAGCTGG + Intergenic
1022042203 7:26591809-26591831 TCTTGTCAGTAAAATGGTGGTGG - Intergenic
1022086047 7:27068649-27068671 TCTTCTCTGAAAAGTGTGGAGGG - Intergenic
1022185361 7:27962005-27962027 CCTTATCTATAAAATGAAGATGG + Intronic
1022270805 7:28805790-28805812 TCCCATCTGTAAAATGGGGCTGG + Intronic
1022653074 7:32294504-32294526 TCTCATCTGTAAAATGAACAGGG + Intronic
1022673316 7:32476270-32476292 CCTACTCTGCAAAATGGGGATGG - Intergenic
1022983341 7:35625310-35625332 TTCCATCTGTAAAATGGCGATGG + Intergenic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023320309 7:38989891-38989913 TCATATCTTTAAAATGCTGATGG + Intronic
1023375306 7:39549852-39549874 CCTTATCTATAAAATGGAGAGGG + Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023821714 7:43984312-43984334 CCCTATCTGTAAAATGAGGATGG - Intergenic
1023837331 7:44076041-44076063 CATTTTCTGTAAAATGGAGAAGG - Intronic
1023881024 7:44321518-44321540 CTTTGTCTGTAAAATGGGGCTGG + Intronic
1024218340 7:47266806-47266828 CATGATCTGTAAAATGGGGATGG + Intergenic
1024464675 7:49699846-49699868 TCTTATCTATAGAATTGTGAAGG + Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024758924 7:52570506-52570528 TCTCATCAGTTAAATGGGGCTGG + Intergenic
1025058113 7:55781540-55781562 TCTTCTCCAAAAAATGGGGATGG + Intergenic
1025828291 7:65028620-65028642 TCTTCTCCATAAAATGGGGATGG - Intergenic
1025915817 7:65865053-65865075 TCTTCTCCATAAAATGGGGATGG - Intergenic
1026020105 7:66699388-66699410 TCTCATCTGTAAAATGGGAGTGG + Intronic
1026827475 7:73593583-73593605 TTCAATCTGCAAAATGGGGATGG - Exonic
1026840336 7:73667453-73667475 TCTCTTCTGTAAAATGGGGTTGG - Intergenic
1026849768 7:73717478-73717500 TCCCATCTGTGAAGTGGGGATGG - Intronic
1026865877 7:73823731-73823753 TCTCATCTCTAAGATGGGAATGG + Intronic
1026928959 7:74212573-74212595 TCTCATCTATAAAATGAGGTCGG - Intronic
1027109220 7:75423789-75423811 TCTCATCTGACAAATGAGGAAGG + Intronic
1027227406 7:76252782-76252804 TCTCATCTGCAAAATGGAAAGGG + Intronic
1027522209 7:79223516-79223538 TCTTGTCTGAAAAATGGAGATGG - Intronic
1027987527 7:85312561-85312583 CCTTGTCTCTAAAATTGGGATGG - Intergenic
1028137559 7:87238297-87238319 CTTGATCTGTCAAATGGGGATGG + Intergenic
1028566534 7:92238842-92238864 TCACATCTATAAAATGGGAATGG - Intronic
1028579595 7:92394142-92394164 TCTCATCTTTACAATGTGGATGG + Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029585633 7:101468977-101468999 TCTCATCTGTGAAATGGGGTTGG + Intronic
1029605255 7:101595079-101595101 TCTCATCTATAAAATGGGCCCGG - Intergenic
1029608988 7:101616603-101616625 TTCCATCTGTAAAATAGGGAAGG - Intronic
1029676362 7:102071841-102071863 TCTCATCTGTAAAATGGAACAGG + Intronic
1029749976 7:102537731-102537753 CCCTATCTGTAAAATGAGGATGG - Intergenic
1029767926 7:102636837-102636859 CCCTATCTGTAAAATGAGGATGG - Intronic
1029818659 7:103123677-103123699 TCTTAGCTGTAGAATGGAGCTGG - Intronic
1029900492 7:104034278-104034300 ACTTATCTGTAAATTGGAGTTGG - Intergenic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030694044 7:112565115-112565137 CCTTATCTGTAAGATTGGGATGG - Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1030941650 7:115658331-115658353 TCTTCTCTGTAATGTGGGAAAGG + Intergenic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1031085211 7:117295801-117295823 TCTTATCTGTACAATGGAGAAGG + Intronic
1031492605 7:122407499-122407521 TTTCATATGTGAAATGGGGAGGG - Intronic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1032091146 7:128912275-128912297 TTCTTTCTGTAAAATGGGGATGG - Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032675374 7:134125375-134125397 TCTCATCTGTCTAATGAGGATGG + Intergenic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1032857327 7:135846287-135846309 TCTCATTTGTAAAATGAAGAGGG - Intergenic
1032894719 7:136237537-136237559 TCTTATCTGAACAATGAGCAGGG + Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033679792 7:143583234-143583256 GCTTATATGTAGAATGGAGAAGG - Intergenic
1033692043 7:143746209-143746231 GCTTATATGTAGAATGGAGAAGG + Intergenic
1033731014 7:144179207-144179229 GCTTATGTGTAGAATGGAGAAGG + Intergenic
1033811664 7:145020831-145020853 CTTTTTCTGTAAAACGGGGATGG + Intergenic
1034384778 7:150731890-150731912 CCTTATCTGTAATATGGGGGAGG + Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035625472 8:1067555-1067577 TCCCATCTGGAAAATGGGCATGG - Intergenic
1036396338 8:8374519-8374541 TGTCATCTGTAAATTGGGGCTGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037628994 8:20635377-20635399 TCTTATCTGAAAAGTAAGGATGG - Intergenic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1037748322 8:21663593-21663615 TCTCATCTGTCAAATGGAGATGG - Intergenic
1037790502 8:21935735-21935757 TCTTATATATAAAATGGTGTTGG + Intronic
1037994621 8:23343341-23343363 TCTCATCTGTAAGGTGGGGATGG - Intronic
1038003843 8:23413223-23413245 TCTCACCTGTAAAATAGGGAGGG + Intronic
1038041508 8:23727604-23727626 TTTCATCTGTAAAATGGGACTGG - Intergenic
1038389240 8:27179797-27179819 TTCCGTCTGTAAAATGGGGATGG + Intergenic
1038467045 8:27773933-27773955 TATTATTTGTAAAATGGGAATGG + Intronic
1038509709 8:28120714-28120736 TCTTATGTGTAATATGAGGTGGG + Intronic
1038524068 8:28258197-28258219 CCTTGTCTGAAAAATGGAGATGG + Intergenic
1038664676 8:29527983-29528005 TCTTATCTGTAAAGTGGGAAAGG + Intergenic
1038985108 8:32800666-32800688 TCTCATCTAGAAAATGGGGGGGG - Intergenic
1039120853 8:34144664-34144686 TCTCATCTCTTAAATGGGGTTGG + Intergenic
1039559972 8:38504935-38504957 TCTTATCTGTGAAAGAGGGATGG + Intergenic
1040759258 8:50818397-50818419 TTTTATCTGTAAATTAGGCAAGG + Intergenic
1041102358 8:54409233-54409255 TCTTATCTGTGAGATGAAGATGG + Intergenic
1041482396 8:58336442-58336464 GCTCATCTGTAAGTTGGGGATGG - Intergenic
1041696045 8:60737466-60737488 TTTCATCTGTTAAATGAGGAGGG + Intronic
1041984622 8:63907559-63907581 TCTTACCTGCAAAATGGGTATGG - Intergenic
1042122206 8:65500473-65500495 TCTCATTTGTAAATAGGGGATGG - Intergenic
1042125565 8:65534371-65534393 TCTTATGTCTAAAATGAGAATGG - Intergenic
1042224380 8:66504138-66504160 TCTTCTCTGCACAGTGGGGAGGG - Intronic
1042413578 8:68492974-68492996 CCTTCTCTGTAAAATGTAGATGG + Intronic
1042636123 8:70877414-70877436 TGTAATCTGTAAAATGAGGATGG - Intergenic
1042962384 8:74317930-74317952 GCTTAACTGTCAAATAGGGAAGG + Intronic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1043528484 8:81122947-81122969 CTTTATCTGTAAAATGAGAATGG - Intergenic
1043796782 8:84552517-84552539 TCTCCTCTGTAAAATTGGGCAGG - Intronic
1043804003 8:84647927-84647949 TCTCATCTGTAATTTGGGGAAGG + Intronic
1043813906 8:84777954-84777976 TCTTATCTGTAAAATGCGAGAGG + Intronic
1043980984 8:86639037-86639059 CTTTATCTGTAAAATTGAGAAGG + Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044110498 8:88267241-88267263 TCTCAACTGTAAAATGGCAATGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044350841 8:91164707-91164729 TATCATCTGTAAAATGGAAATGG - Intronic
1044465545 8:92499541-92499563 TCTTATGTGTAAAATTCGGTGGG - Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044844314 8:96365402-96365424 CCTCATCTATAAAATAGGGATGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045014079 8:97983726-97983748 TCTTATTTGAAAAATAAGGATGG - Intronic
1045177055 8:99736886-99736908 TCTCATCTGTAAAATAAGAATGG - Intronic
1045205127 8:100030953-100030975 AATTATATGTAAAATGGGCAAGG + Intronic
1045259334 8:100558804-100558826 CCTTATCTGTATAATGGAAATGG + Intronic
1045375735 8:101572003-101572025 CCTTAGCTGTGAAATGAGGAAGG + Intronic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1045404256 8:101849554-101849576 TCCTATCGGAAAAATGGGCAGGG - Intronic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1045811442 8:106224505-106224527 TTTTATCTTTAAATTGGGGCAGG + Intergenic
1045868622 8:106899547-106899569 TCTTATCTGTAAACTAGTGGAGG - Intergenic
1046565341 8:115892389-115892411 TCCCATTTATAAAATGGGGATGG - Intergenic
1046582744 8:116113239-116113261 GCTTATTTGTAAAATTGGCAGGG + Intergenic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047301927 8:123620935-123620957 TCCCATCTGTAGAATGGGAATGG + Intergenic
1047506538 8:125485081-125485103 CCTTATCTCTAAAGTGGGGAGGG + Intergenic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047621196 8:126609852-126609874 TTTTATCTGTAAAAATGAGAAGG - Intergenic
1047774642 8:128059755-128059777 CCCCATGTGTAAAATGGGGATGG - Intergenic
1047797263 8:128270463-128270485 CCTCATTTGTAAAATGGAGATGG - Intergenic
1047873030 8:129106091-129106113 CCTGGCCTGTAAAATGGGGATGG + Intergenic
1048070386 8:131014732-131014754 TCTCATATGTTAAATGGGAATGG + Intronic
1048160286 8:132014224-132014246 TCTCATCTGTAAAGTGAGCATGG + Intergenic
1048234320 8:132675248-132675270 CCTAATCTGTAAAATGGGCGGGG - Intronic
1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG + Intronic
1048468248 8:134685177-134685199 TCTCCTCTGTAAAAAGGGGATGG - Intronic
1048509665 8:135050774-135050796 CCTTAGCTGTAAAATGGGGCTGG + Intergenic
1048569937 8:135643810-135643832 CCTTATCTGTCAAATGGGTATGG + Intronic
1048580391 8:135725655-135725677 CCTTCTCTGTAAAGTGGGAACGG - Intergenic
1048667251 8:136676335-136676357 TCTCATCTGTAAAATAGAGTTGG + Intergenic
1048781788 8:138009464-138009486 TTTAATCTGTAAAATGGGAATGG - Intergenic
1048809468 8:138272954-138272976 CCTCATCTGTGAACTGGGGATGG + Intronic
1048973923 8:139660795-139660817 TCCCATCTGGAAAATGGGAATGG - Intronic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1049114396 8:140673471-140673493 TAATATCTCTAAAATTGGGATGG - Intronic
1049123902 8:140768192-140768214 TCTTGCCTGTGAAATAGGGATGG - Intronic
1049161100 8:141098458-141098480 TCTCATCTGTAAAGTGGGTGGGG - Intergenic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1049264850 8:141662413-141662435 TCTTTTCTGTAAAATGTGGGTGG - Intergenic
1049419139 8:142509300-142509322 CCTCATCTTTAAAATGGGGGTGG - Intronic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1049944793 9:583276-583298 TTTTATCTGTAAAAGAGGAATGG + Intronic
1050150442 9:2614506-2614528 TTTCATCTGAAAAATGGGGGTGG - Intergenic
1050186930 9:2984464-2984486 TCTTAACTGTAATGTGGGGATGG + Intergenic
1050459662 9:5866880-5866902 CCTCATCTGTAAAATGGGACTGG + Intergenic
1050739392 9:8802748-8802770 CCTCATCTTTAAAATGGAGATGG + Intronic
1050802043 9:9627532-9627554 TCTTCTCTGTAAGGTGGGGCTGG + Intronic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1051584016 9:18707569-18707591 TCTCATCTGTAAGATGGGGGTGG - Intronic
1052354990 9:27494840-27494862 TCTTATGTGGAATAGGGGGAGGG - Intronic
1053020814 9:34692659-34692681 CCTTATTTGTAAAATGGGAATGG + Intergenic
1053138331 9:35665498-35665520 TCCTATCTGGAGAATTGGGACGG + Intronic
1053350269 9:37409390-37409412 CCTTATCTGTAAGATGGGGATGG + Intergenic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053446905 9:38159594-38159616 CCTCATTTGTTAAATGGGGATGG - Intergenic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1053887620 9:42656395-42656417 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1054226642 9:62463845-62463867 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1054711538 9:68516051-68516073 TCTTATTTGTAAAACATGGATGG - Intronic
1054784720 9:69199889-69199911 CCCTATTTGTAAAATGGGGATGG + Intronic
1054828796 9:69600352-69600374 CCTCATCTGTAAAATGGGAGTGG + Intronic
1054830661 9:69621061-69621083 CCTGATCTGTAAAATGGAGTTGG + Intronic
1055289638 9:74769450-74769472 TCTTATTTGTAAAATAGACATGG - Intronic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056071103 9:82987793-82987815 TCTAATCTGTAAAATGAGGGAGG - Intronic
1056296543 9:85198814-85198836 CCTTATCCCTAAAATGAGGATGG + Intergenic
1056431710 9:86534641-86534663 TTTTCTCTGTATAATGGGTAAGG + Intergenic
1056444587 9:86653537-86653559 TCCTATCTGTAAAATAGGTATGG - Intergenic
1056466562 9:86861425-86861447 GCTTATCTGTTCAATGGAGATGG + Intergenic
1056763315 9:89429403-89429425 TCTTAGCTGCAAAAGAGGGATGG - Intronic
1056786739 9:89597942-89597964 TCCTATCTGTGAAGTGGGCATGG + Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057199350 9:93132109-93132131 TCTCATCTGTGAAATGGGTGTGG - Intronic
1057621026 9:96635211-96635233 TCTTCTCTGCAAAATGGTGATGG + Intergenic
1057695569 9:97320600-97320622 CCTCCTCTGTAAAATAGGGATGG + Intronic
1057774271 9:97993247-97993269 CCTTCTCTGTAAATGGGGGAAGG + Intronic
1057824918 9:98365018-98365040 TCTCATTTGTAAAATGGGCAGGG + Intronic
1057908004 9:98997213-98997235 TCTTGTCTGTAAAATGAGGGTGG - Intronic
1057920889 9:99095662-99095684 TTTTGTCTGTGTAATGGGGAGGG - Intergenic
1058054701 9:100437466-100437488 TCTTATCTGGGAAATGGGAATGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058674535 9:107389184-107389206 CCTCAACTGTAAAATGGAGATGG + Intergenic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1058805445 9:108586799-108586821 CCTCATGTGTGAAATGGGGATGG - Intergenic
1058954993 9:109937871-109937893 TCTTATTTAAAAAATGAGGAGGG - Intronic
1059404620 9:114092233-114092255 TCTTATCTCTGAAATGGGGTGGG - Intronic
1059459286 9:114419753-114419775 TAGGATCTGTAAAATGAGGATGG - Intronic
1059480486 9:114585614-114585636 TCTTATGTGTAAAAGAGGCAAGG + Intergenic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1059665265 9:116440326-116440348 TCCTATCTGTAAAATGAGGTGGG + Intronic
1059694344 9:116716497-116716519 TCCCATCTGTAGAATGGGAATGG + Intronic
1059788643 9:117615628-117615650 CCTAATCTGTAAAATGGGAATGG - Intergenic
1059923316 9:119181469-119181491 TCTTATCTGTCAAATGGGGAAGG + Intronic
1059925412 9:119204514-119204536 CTTTATCTGTAAAATAGGAATGG + Intronic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060052309 9:120386155-120386177 TCTCATTTGTAAAATGGGTGAGG + Intergenic
1060141256 9:121212337-121212359 CCTCATCTGTAAAATAGGTATGG + Intronic
1060153742 9:121304735-121304757 TCTCATCTGTAAAATGGAATGGG - Intronic
1060238445 9:121883251-121883273 TCTCTTCTGTAAAATGGAGATGG + Intronic
1060262655 9:122090221-122090243 GCTTATCTGTAAAGTAGGGGTGG - Intronic
1060392756 9:123291901-123291923 TCTCATCTGTAAAATGTGCAGGG - Intergenic
1060514518 9:124257742-124257764 TCCCATCTCTGAAATGGGGAAGG + Intronic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060568921 9:124619702-124619724 CCTTATCTGTAAAATAGGGAGGG + Intronic
1060571063 9:124641032-124641054 TATTATCTATAAAATGGGGGTGG - Intronic
1060571240 9:124642365-124642387 TATTATCTATAAAATGGGGATGG + Intronic
1060583595 9:124772047-124772069 CCCTATCTGTAAAAGGGGGTTGG + Intergenic
1060801886 9:126550176-126550198 TCAAATCTGTAAAGTGGGGATGG - Intergenic
1060825718 9:126686793-126686815 GCTCATCTGTAAAATGGGAATGG + Intronic
1060829298 9:126703748-126703770 TCTTATCTGTGCAATGGGCTAGG - Intergenic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061039023 9:128128896-128128918 CCCTATCTGTAAAACGGGGCTGG - Intergenic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061165372 9:128919297-128919319 TCTCATTTGTAAAATCAGGAAGG + Intergenic
1061226950 9:129285974-129285996 CCTTGTCTATAAAATGGGGATGG - Intergenic
1061676279 9:132217744-132217766 TCTAATCTGTAAAATAAGGATGG - Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1061884417 9:133584371-133584393 TCTTATCTGTACAATGGGTGTGG + Intronic
1061894559 9:133640438-133640460 GCCCATCTGTAAAATGGAGATGG + Intronic
1061901088 9:133672443-133672465 CCTTGTCTGTAAGATGGGGTTGG + Intronic
1062010516 9:134264386-134264408 CCTCATCTCTGAAATGGGGATGG + Intergenic
1062208319 9:135349276-135349298 TCTTTTCTTTAAAATGGGGCTGG - Intergenic
1062266588 9:135689364-135689386 TCTCATCTGTCAAATGGGCTTGG - Intergenic
1203776553 EBV:76246-76268 TCTTTACTGCGAAATGGGGAAGG + Intergenic
1185704987 X:2260206-2260228 TCTTATATGTAGAGTGGGGTCGG + Intronic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186257151 X:7734488-7734510 TGTTGTCCATAAAATGGGGATGG + Intergenic
1186503981 X:10075243-10075265 TTTAATCTATAAAATGGGCAAGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1187590798 X:20714993-20715015 ACTTATTTGTAAAATAGGGAGGG + Intergenic
1187769943 X:22683873-22683895 ACTTATTTGTGAAATGGGGATGG + Intergenic
1188617513 X:32176568-32176590 TCATATCAGTAAAGTGGGGACGG + Intronic
1189144797 X:38644701-38644723 TCTCATTTGTAAAATTGTGAGGG + Intronic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189352171 X:40283896-40283918 CCTCATCTGTAAGGTGGGGATGG + Intergenic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190489405 X:50966347-50966369 CCTCATTTGTAAAATGGAGATGG + Intergenic
1190916345 X:54814057-54814079 CCTCAACTGTAAAACGGGGATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1191866354 X:65706848-65706870 TCTCATCTATGAAGTGGGGATGG + Intronic
1192151723 X:68716955-68716977 TCCTATCTGTAAAATTGGAAGGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192496251 X:71618199-71618221 TCTCGTCTGCAAAATGGGGGGGG - Intronic
1192549595 X:72043457-72043479 CCTTGTGTGTAAAATGGGGATGG - Intergenic
1192833294 X:74773098-74773120 GCATATCTTTAAAATGGGGCAGG - Intronic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1194713745 X:97266606-97266628 TCTAATTTGTAAAGTGGGGTGGG + Intronic
1195386204 X:104315598-104315620 TCTTTTCTGGACACTGGGGAGGG + Intergenic
1195767770 X:108314777-108314799 TCCTATCTGTAAAATGAGGATGG + Intronic
1195768466 X:108321909-108321931 TTTTATCTGTAAAATGATAATGG - Intronic
1195916014 X:109936045-109936067 CCTCATCTGTAATATAGGGATGG + Intergenic
1196141651 X:112269294-112269316 GCTGATTTGTAAAATGGGAATGG - Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1196829169 X:119762847-119762869 TCGCATCTATAAAATGGGCACGG - Intergenic
1196919218 X:120568743-120568765 TCTTATCTGTACAGTGGGGATGG - Intronic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197464564 X:126786558-126786580 TTTCATTTGTTAAATGGGGATGG + Intergenic
1197721736 X:129749897-129749919 CCTTATCTGTAAAATGGGATGGG + Intronic
1197721763 X:129750191-129750213 GCACATTTGTAAAATGGGGATGG - Intronic
1197722533 X:129755047-129755069 TCCTATCCGTAAAATGGAGGTGG + Intronic
1197893374 X:131287240-131287262 GTTCATCAGTAAAATGGGGATGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1198445116 X:136705551-136705573 TCTTATCTGTAAAGCAGAGATGG + Intronic
1198653977 X:138893449-138893471 CCCTATCTTTAAAATGGGGGTGG - Intronic
1199058133 X:143321472-143321494 TCTTATCTATCAAAGGAGGAGGG + Intergenic
1199503833 X:148539269-148539291 TATCATCCATAAAATGGGGAGGG - Intronic
1199540545 X:148953444-148953466 TCCTATCTATAAAATGGGAACGG + Intronic
1199562161 X:149174371-149174393 CCTTATCTGTAAAACAGGAAGGG + Intergenic
1199760451 X:150900183-150900205 TCTCATGTGTCAAAGGGGGAGGG + Intergenic
1200059652 X:153478603-153478625 TCTCCTCTGTAAAATGGGGTAGG - Intronic
1200231155 X:154444520-154444542 TCTCATCTGTGAAATGGGCCTGG + Intronic
1200336094 X:155353110-155353132 TTTCATTTGTAAAATGGAGATGG - Intergenic
1200350376 X:155488117-155488139 TTTCATTTGTAAAATGGAGATGG + Intergenic
1200829525 Y:7677781-7677803 TTTTATCTGTAAAAGGGGATGGG - Intergenic
1201332166 Y:12836473-12836495 TCTTAGCTTTAAAGTAGGGATGG + Intronic
1201782999 Y:17743863-17743885 TCTCACCTCTAAAATAGGGATGG - Intergenic
1201818554 Y:18162124-18162146 TCTCACCTCTAAAATAGGGATGG + Intergenic
1202109243 Y:21404571-21404593 TTTTATCTGTAAAAGGGGATGGG - Intergenic
1202379793 Y:24266373-24266395 TCTTATCTGTAAAGCTGGAAGGG - Intergenic
1202490989 Y:25403748-25403770 TCTTATCTGTAAAGCTGGAAGGG + Intergenic