ID: 1137574896

View in Genome Browser
Species Human (GRCh38)
Location 16:49593059-49593081
Sequence TGTATGGGGGAGTGAAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 0, 3: 50, 4: 503}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137574884_1137574896 28 Left 1137574884 16:49593008-49593030 CCAAACCAAAATCCTTCAAATAC 0: 1
1: 0
2: 1
3: 25
4: 288
Right 1137574896 16:49593059-49593081 TGTATGGGGGAGTGAAGAGAAGG 0: 1
1: 0
2: 0
3: 50
4: 503
1137574882_1137574896 30 Left 1137574882 16:49593006-49593028 CCCCAAACCAAAATCCTTCAAAT 0: 1
1: 0
2: 0
3: 34
4: 440
Right 1137574896 16:49593059-49593081 TGTATGGGGGAGTGAAGAGAAGG 0: 1
1: 0
2: 0
3: 50
4: 503
1137574883_1137574896 29 Left 1137574883 16:49593007-49593029 CCCAAACCAAAATCCTTCAAATA 0: 1
1: 0
2: 2
3: 37
4: 514
Right 1137574896 16:49593059-49593081 TGTATGGGGGAGTGAAGAGAAGG 0: 1
1: 0
2: 0
3: 50
4: 503
1137574885_1137574896 23 Left 1137574885 16:49593013-49593035 CCAAAATCCTTCAAATACCTGAT 0: 1
1: 0
2: 0
3: 25
4: 297
Right 1137574896 16:49593059-49593081 TGTATGGGGGAGTGAAGAGAAGG 0: 1
1: 0
2: 0
3: 50
4: 503
1137574886_1137574896 16 Left 1137574886 16:49593020-49593042 CCTTCAAATACCTGATCAAGATG 0: 1
1: 0
2: 2
3: 7
4: 125
Right 1137574896 16:49593059-49593081 TGTATGGGGGAGTGAAGAGAAGG 0: 1
1: 0
2: 0
3: 50
4: 503
1137574889_1137574896 6 Left 1137574889 16:49593030-49593052 CCTGATCAAGATGGATTTGGAGG 0: 1
1: 0
2: 1
3: 13
4: 149
Right 1137574896 16:49593059-49593081 TGTATGGGGGAGTGAAGAGAAGG 0: 1
1: 0
2: 0
3: 50
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137574896 Original CRISPR TGTATGGGGGAGTGAAGAGA AGG Intronic
900493444 1:2964883-2964905 TATGTGGGTGAGTGAATAGATGG - Intergenic
900608165 1:3533035-3533057 TGTAGTGGAGAGTGGAGAGAAGG - Intronic
900747135 1:4368085-4368107 TGTCTGGGAGAATGGAGAGAAGG + Intergenic
900836467 1:5008587-5008609 TGAATGGGTGAGTGGAGGGATGG + Intergenic
900915374 1:5634843-5634865 TGTATGGGGGTGGGATGAGGTGG - Intergenic
900993215 1:6107284-6107306 GGGATGGCGGAGTGGAGAGATGG + Intronic
901332042 1:8417709-8417731 TGTATGGGTGAGTGTGGGGATGG - Intronic
901409177 1:9071071-9071093 ACGATGGGGGAGTGAGGAGACGG + Intronic
901508757 1:9703501-9703523 GGTTTGGGGGAGTGACTAGAAGG - Intronic
902951257 1:19884374-19884396 TGTATGGGGGTGTGGGGATAGGG - Intronic
903206558 1:21786753-21786775 GGGATGTGGGAGTCAAGAGAGGG - Intergenic
903369172 1:22824255-22824277 TGGATGGGGGAAGGAAGGGAGGG + Intronic
903682648 1:25107327-25107349 GGAATGGGGGGGTGAGGAGAGGG + Intergenic
903833518 1:26188752-26188774 TGTCTGTGGGAGGGAAGAGCAGG - Exonic
904598999 1:31663608-31663630 TGAAGTGGGGACTGAAGAGAGGG + Intronic
904977827 1:34472193-34472215 GGTATTGGGGAGTGGAGAGTGGG - Intergenic
905698467 1:39993633-39993655 TGTATAAGGTAGTGAAGAAAAGG - Intergenic
905910764 1:41652436-41652458 TGCCTGGAGGAGTGAGGAGAAGG + Intronic
906388746 1:45395150-45395172 GGTATGTGGAAATGAAGAGAGGG - Intronic
907729716 1:57054151-57054173 TACATGGGGGAATGAAGAGAGGG + Intronic
907866594 1:58405086-58405108 TGTTTCTGGGAGTGGAGAGAGGG - Intronic
908006278 1:59732492-59732514 TGAATGGGGAAGTGCAGGGAGGG + Intronic
908563058 1:65326339-65326361 TCTATGAGGGAGTTCAGAGAAGG + Intronic
908736871 1:67285712-67285734 TGTTTGGAGGAGAGCAGAGAAGG - Intergenic
909007552 1:70294978-70295000 AGTAAGGGGGAGAGAGGAGAAGG - Intronic
909425552 1:75520487-75520509 TGAATGGGGGCATGAACAGAAGG + Intronic
910041326 1:82855197-82855219 TGCATGAGGGAATGAAGAAAGGG - Intergenic
912239673 1:107892474-107892496 TTTACAGGGGAGTGAAGAGATGG - Intronic
912428220 1:109612925-109612947 TGTATGTGAGATGGAAGAGAAGG + Exonic
913176087 1:116274373-116274395 AGTATGGAGGAGTGAGGAGATGG - Intergenic
913278890 1:117166094-117166116 TGCATGGAGGTGTGAATAGATGG - Intronic
913310098 1:117481356-117481378 TGTATTGAGAAGTGAACAGAAGG - Intronic
914356656 1:146891127-146891149 TGAATGGGGGAAATAAGAGAAGG + Intergenic
914755571 1:150559916-150559938 TGTATTGGGGATTGGGGAGAGGG - Intronic
914802656 1:150972631-150972653 TGTATGGGGGAGTGAAGTCTGGG - Intronic
915304474 1:154969818-154969840 GGGGTGGGGGAGTGAAAAGAAGG + Intronic
915518680 1:156428937-156428959 TGTCTGGTGGAGAGAAGGGAGGG + Intronic
915557687 1:156669520-156669542 TGAATGGGGGAGTGATGAACGGG - Exonic
915864905 1:159489047-159489069 TGTATGTGGGAGTGGGGAGAGGG - Intergenic
915997664 1:160580627-160580649 TGTTTTGGGGAGTAATGAGAAGG + Intergenic
916107470 1:161441959-161441981 TGTTTGGGCGAGTGAGGAGAAGG - Intergenic
916109055 1:161449377-161449399 TGTTTGGGCGAGTGAGGAGAAGG - Intergenic
916110642 1:161456758-161456780 TGTTTGGGCGAGTGAGGAGAAGG - Intergenic
916112228 1:161464168-161464190 TGTTTGGGCGAGTGAGGAGAAGG - Intergenic
916113815 1:161471549-161471571 TGTTTGGGCGAGTGAGGAGAAGG - Intergenic
916408952 1:164525748-164525770 TTAATGGGGGAGGGAAGTGAAGG + Intergenic
916753030 1:167740891-167740913 TGGACATGGGAGTGAAGAGAAGG - Intronic
917899145 1:179524704-179524726 TGGCTGCGGGAATGAAGAGAAGG - Intronic
918208776 1:182332614-182332636 TGCATCTGGGAGTGAAGAGAGGG - Intergenic
921240553 1:213177086-213177108 TGCATGTGGGTGTGAAGTGAGGG - Intronic
922081987 1:222306285-222306307 TGTAAAGGGTGGTGAAGAGAGGG - Intergenic
922486338 1:225975996-225976018 TGTGTAGGGGAGTGTAGGGACGG + Intergenic
922799677 1:228359577-228359599 TCTCTGGGGGAGGGAGGAGAGGG - Intronic
923419499 1:233798706-233798728 TGGATGGGGGAGTCAGGAGGAGG - Intergenic
923867617 1:237956995-237957017 TGTATGTGTGTGTGTAGAGATGG + Intergenic
924151937 1:241138442-241138464 TGTATAGGGGAGAGTAAAGAGGG + Intronic
924251000 1:242133017-242133039 TGTGCGGGGGTGGGAAGAGAGGG - Intronic
924372133 1:243361987-243362009 TGGATAGGTGGGTGAAGAGATGG + Intronic
924372141 1:243362044-243362066 TGGATAGGTGGGTGAAGAGATGG + Intronic
924372149 1:243362101-243362123 TGGATAGGTGGGTGAAGAGATGG + Intronic
924372173 1:243362272-243362294 TGGATAGGTGGGTGAAGAGACGG + Intronic
1063114213 10:3062435-3062457 TGAATGAGGGAGTGAATTGAAGG - Intergenic
1063609053 10:7547740-7547762 TGTATGGGAGAGGGAGGAGTGGG - Intergenic
1064021215 10:11810703-11810725 TGTAGGGGGAAGGGAAGGGAGGG - Intergenic
1064320921 10:14303748-14303770 AGTAAGGGGGAATGAAGAGGGGG - Intronic
1064478442 10:15716600-15716622 TGTATGGGAGAGTGAATTCAAGG + Intronic
1066046227 10:31597874-31597896 TGTGAAGGGGAGTCAAGAGAGGG + Intergenic
1066250302 10:33626549-33626571 TGTATGAGGTGGTGATGAGAAGG + Intergenic
1067087189 10:43249223-43249245 GGTGTGGGGCAGTGAGGAGATGG - Intronic
1067474980 10:46558863-46558885 TGCATGGGGGAAGGAAGGGATGG + Intergenic
1068627091 10:59261241-59261263 TGTTGTGAGGAGTGAAGAGAAGG - Intronic
1069611543 10:69775893-69775915 TGGTTGGGGGAATGGAGAGAAGG + Intergenic
1070558768 10:77550193-77550215 TGGATGGGAGAGTGAAGGGTTGG + Intronic
1071636010 10:87254835-87254857 TGTGTGGGAGAGAGAAGATAGGG - Intergenic
1071659230 10:87483109-87483131 TGTGTGGGAGAGAGAAGATAGGG + Intergenic
1071915137 10:90286598-90286620 TGATTGGGGGAGAGAAAAGAGGG + Intergenic
1072021523 10:91408103-91408125 TGTATGAGGGAGGGATGAGGTGG + Intergenic
1072054190 10:91737744-91737766 TTTAGGGGGGAGTGTAGAGATGG + Intergenic
1072693520 10:97586857-97586879 TGTGTGGGTGAGTGATCAGATGG - Intronic
1075723227 10:124599152-124599174 TGGATGGGTGAGTGGACAGATGG - Intronic
1076458229 10:130619457-130619479 TGAATGAATGAGTGAAGAGAGGG - Intergenic
1076564173 10:131386852-131386874 TGAAGGGAGGAGTGGAGAGAGGG + Intergenic
1077480953 11:2814328-2814350 TGTGTGGGTGGGTGGAGAGATGG + Intronic
1077480973 11:2814427-2814449 TGGATGGGGAAATGAAGAGATGG + Intronic
1077600793 11:3573117-3573139 TGTATGGGGAAGAGAAAGGAGGG - Intergenic
1077892244 11:6427647-6427669 GGAATGTGGGAGTGAAGTGAGGG + Intergenic
1078409378 11:11099431-11099453 TGTAAGAGGGAGAGAAGAGGAGG + Intergenic
1078960859 11:16268040-16268062 GGTATGGGGAAATGGAGAGATGG + Intronic
1079210074 11:18453491-18453513 GGTATGGGGGAGGGAGGAAAAGG + Intergenic
1081652385 11:44833061-44833083 TCTATGGAGCAGTGAAGGGAGGG - Intronic
1081781172 11:45714082-45714104 TGAATGGGGGTGGGAGGAGAAGG - Intergenic
1081975204 11:47229422-47229444 TGGTTGAGGGAGTGGAGAGAGGG + Intronic
1082007037 11:47425091-47425113 TGTATGTGGAGGGGAAGAGAGGG - Intronic
1084006027 11:66324059-66324081 TGGGTGGGAGAGTGAATAGATGG + Intergenic
1084256713 11:67947702-67947724 TGTATGGGGAAGAGAAAGGAGGG - Intergenic
1084445092 11:69199026-69199048 TGTATGGAGGGGTGGAGAGATGG - Intergenic
1084461544 11:69299151-69299173 TCCAAGGGGGAGGGAAGAGAAGG + Intronic
1084816077 11:71647672-71647694 TGTATGGGGAAGAGAAAGGAGGG + Intergenic
1084893566 11:72249694-72249716 GGGATGGGGGAGTCAAGGGAAGG - Intergenic
1085246237 11:75103862-75103884 TGGACTGAGGAGTGAAGAGAAGG - Intronic
1085947855 11:81293642-81293664 TGTCTGTAGGAATGAAGAGATGG - Intergenic
1086061426 11:82703527-82703549 TGTATGGTGGAATTAAGAGATGG - Intergenic
1087352302 11:97047436-97047458 AGTATGGGTTAGTGAAGGGAGGG - Intergenic
1087841714 11:102927477-102927499 TGTATGGGACTGTGAGGAGAGGG + Intergenic
1088091522 11:106045912-106045934 TGCCTGGGGGATTGAAAAGAAGG + Intergenic
1089247809 11:117135460-117135482 TGTACGTGGGGGTGAAGTGAAGG + Intergenic
1089258905 11:117209101-117209123 TGTACGTGGGGGTGAAGTGAAGG - Intronic
1089480010 11:118797003-118797025 TGTATGGGGGGAGGAAGAGTAGG - Intergenic
1090523794 11:127506927-127506949 TGGAGGGTGGAATGAAGAGATGG + Intergenic
1091446336 12:546043-546065 AGTAGGGAGGAGTGAAGAGTGGG + Intronic
1091870381 12:3885103-3885125 TGTATTGGGCTTTGAAGAGAAGG - Intergenic
1092239360 12:6827888-6827910 TGTGTGGGGGAGTGCAGGGGTGG + Intronic
1092426927 12:8382375-8382397 TGTATGGGGAAGAGAAAGGAGGG - Intergenic
1092729705 12:11518373-11518395 TCTATGAGGGGTTGAAGAGAAGG - Intergenic
1092815431 12:12308585-12308607 TGAATGGGTGAGTGAAATGAAGG + Intergenic
1092815668 12:12310468-12310490 CGTATGGGACAGTGAGGAGATGG - Intergenic
1093469944 12:19490015-19490037 TGCATGGGGGAGGTTAGAGATGG + Intronic
1093873003 12:24314700-24314722 TGCATGAAGGAGTGAATAGAAGG - Intergenic
1094161780 12:27398313-27398335 TGTGTGTGGGGGTGAGGAGAGGG - Intronic
1095384240 12:41631391-41631413 TGTATGGGGGAGGACAGAGGAGG + Intergenic
1095991881 12:48040589-48040611 TGAAGGGTGGAGTGAAAAGATGG - Intergenic
1096422783 12:51474639-51474661 TGTAGGGGGGAGAAAAGAGAAGG - Intronic
1096666620 12:53170537-53170559 TTGATGGGGGAGGGGAGAGAAGG + Intronic
1096759778 12:53831279-53831301 TGTGTGGTGGAATGGAGAGAAGG - Intergenic
1096847711 12:54417274-54417296 GGGAGGGGGGAGTAAAGAGAAGG + Intronic
1097562528 12:61224951-61224973 GGTATAGGAGAGGGAAGAGAAGG - Intergenic
1100874017 12:98943627-98943649 TGGAAGGGGGAATGAAAAGAGGG - Intronic
1100972310 12:100083423-100083445 GGTATGGGGGAGGGAAGGGGAGG + Intronic
1101337924 12:103813207-103813229 TTTAGGGGGTAGTGAACAGATGG + Intronic
1101631467 12:106499198-106499220 TGGGTGGAGAAGTGAAGAGAAGG - Intronic
1102504204 12:113373636-113373658 TGGATGAGTGAGTGAATAGATGG - Intronic
1103888686 12:124222254-124222276 TTTCTGTTGGAGTGAAGAGAAGG + Intronic
1104542257 12:129676869-129676891 TGTGTGGGTGAGTGAGTAGATGG - Intronic
1104578004 12:129985913-129985935 TGGTTGGGGGAGGGAAGAGAAGG + Intergenic
1104671673 12:130685118-130685140 GGTGTGGGGGAGATAAGAGAGGG - Intronic
1105465586 13:20636681-20636703 TGTGTTGGGGACTGGAGAGATGG - Intronic
1105881656 13:24611448-24611470 TGGATGGATGGGTGAAGAGATGG + Intergenic
1106404233 13:29459912-29459934 AGGTTGGTGGAGTGAAGAGAGGG - Intronic
1106674207 13:31940482-31940504 TGTCAGGGGTAGTGTAGAGAGGG + Intergenic
1107113097 13:36718904-36718926 TGTGTGGAGGAGTGACGAAAAGG - Intergenic
1108221419 13:48237127-48237149 TTTTTTGGGGAGTGAGGAGAAGG + Intronic
1108776211 13:53768275-53768297 TGTAAAAGGGAGTAAAGAGATGG + Intergenic
1109478913 13:62921258-62921280 AGTATGGGGTAGTGACTAGAAGG - Intergenic
1111450569 13:88409570-88409592 TATATGGGAGCATGAAGAGATGG - Intergenic
1111966235 13:94864910-94864932 TGGAGGGAGGAGAGAAGAGAGGG - Intergenic
1112508194 13:99987987-99988009 TGGGTGGGGGAGTGACCAGAGGG + Intergenic
1112877339 13:104059969-104059991 GATATGGCAGAGTGAAGAGATGG + Intergenic
1113340285 13:109416284-109416306 TGGATGGGCGGGTGAAGAGGAGG - Intergenic
1114240035 14:20858261-20858283 TAAATGGGAGAGTTAAGAGAAGG - Intergenic
1115150135 14:30275309-30275331 TGTGGGCGGGGGTGAAGAGATGG - Intergenic
1115159977 14:30383075-30383097 AGGATGGAGGAGTGGAGAGAAGG + Intergenic
1115334720 14:32233592-32233614 GATATGGGGAAGTGAAGAGAAGG + Intergenic
1116281366 14:42913408-42913430 GGTGTGGGGGAGTGAGGGGAGGG - Intergenic
1116619986 14:47189200-47189222 TGGATGGGGGAGGGAGGGGATGG - Intronic
1117487681 14:56214263-56214285 TTGATGGGGGAGGGGAGAGAGGG + Intronic
1118247779 14:64128118-64128140 AGTATGTTGGAGTAAAGAGAAGG + Intronic
1119564793 14:75619341-75619363 TGTATGGGAAAGTAAGGAGAGGG - Intronic
1119568593 14:75649975-75649997 TTTTTGGGGGTGGGAAGAGATGG - Exonic
1119754472 14:77105306-77105328 GGGACAGGGGAGTGAAGAGAAGG - Intronic
1120172643 14:81261119-81261141 TATAGGGGTGAGGGAAGAGAAGG - Exonic
1121485141 14:94308982-94309004 TGGATGGGTGAGTGAATGGATGG - Intronic
1121865391 14:97358031-97358053 TGAATGGGTGAGAGAATAGATGG + Intergenic
1122253898 14:100462937-100462959 AGGAAGGGGGAGAGAAGAGAAGG - Intronic
1122253914 14:100462992-100463014 AGGAAGGGGGAGAGAAGAGAAGG - Intronic
1122341380 14:101030695-101030717 TGGATGGGGGACTGAGGAGCTGG + Intergenic
1122683216 14:103483172-103483194 TATATGGGTGGGTGAAGAGAGGG - Intronic
1123058800 14:105585188-105585210 TGAATGGATGAATGAAGAGATGG - Intergenic
1123083128 14:105705414-105705436 TGAATGGATGAATGAAGAGATGG - Intergenic
1123986216 15:25648526-25648548 TGGATGGGTGGGTGGAGAGATGG + Intergenic
1125003303 15:34793742-34793764 TCTTTGGGGGAGTGGGGAGAAGG - Intronic
1125484819 15:40104552-40104574 TGAATGGAGAAGCGAAGAGAAGG - Intronic
1127005068 15:54559630-54559652 AGGATGGGGGAGGGCAGAGAGGG + Intronic
1127332473 15:57952380-57952402 TTTATGTGACAGTGAAGAGATGG - Intergenic
1127690542 15:61391814-61391836 TGGAACTGGGAGTGAAGAGATGG + Intergenic
1128253878 15:66183174-66183196 TGTCTGCGGGAGTGAGGAGAGGG + Intronic
1128454556 15:67825373-67825395 GGTAGAGGGGGGTGAAGAGAAGG - Intronic
1128565713 15:68699463-68699485 TGGCTGGAGGAGTGAAGGGAAGG + Intronic
1128743733 15:70099578-70099600 CGTAAGGGGGAGGGCAGAGAAGG - Intergenic
1129505579 15:76078979-76079001 TGGATGGGGCAGAGAAGAGAGGG - Intronic
1131376597 15:91929390-91929412 CATCTTGGGGAGTGAAGAGAGGG + Intronic
1132232241 15:100192872-100192894 TGTCTGGGGGAGTGATGGGGAGG - Intronic
1132312215 15:100865515-100865537 TGTATGGAGAAGTGCAGAAAGGG - Intergenic
1132933035 16:2468351-2468373 TGGACGGAGGAGGGAAGAGAGGG - Intergenic
1133104726 16:3500130-3500152 TGCATGGGGGCGCGAGGAGACGG - Intergenic
1133111610 16:3551280-3551302 TGGATGGGTGAGTGGATAGATGG - Intronic
1133371334 16:5247989-5248011 TGTATGGGGAAGAGAAAGGAGGG + Intergenic
1133416561 16:5611754-5611776 TGGATGGGAGACTGAAAAGAAGG - Intergenic
1133613998 16:7458778-7458800 GGTGTGTGGGAGTGAAGAGGGGG - Intronic
1133692628 16:8231262-8231284 GGGATGGGGGAGCGAGGAGAAGG - Intergenic
1134128060 16:11629972-11629994 GGTGTTGGGGAGGGAAGAGAAGG + Intronic
1134739844 16:16532913-16532935 TGGATGGATGAGTGAATAGATGG - Intergenic
1134927655 16:18179251-18179273 TGGATGGATGAGTGAATAGATGG + Intergenic
1135331396 16:21562975-21562997 TGTATGGGAGAGAGAAAAGGAGG - Intergenic
1135394724 16:22122454-22122476 TGGATGGAGGAGTGAAAGGATGG + Intronic
1136279095 16:29197609-29197631 TGGATGGGTGAGTGAATGGATGG + Intergenic
1136472649 16:30491972-30491994 TGGAAGGAAGAGTGAAGAGACGG - Intronic
1136733532 16:32441576-32441598 TGTCTGTGGCAGTGAAGACAAGG + Intergenic
1137574896 16:49593059-49593081 TGTATGGGGGAGTGAAGAGAAGG + Intronic
1138051647 16:53784891-53784913 TGTATGTGGGAGTGCAGAGTGGG + Intronic
1138115235 16:54355765-54355787 TGTGTGGAGGGGTGAAGACAAGG - Intergenic
1138547836 16:57729963-57729985 TGGATGGGCGAGTGGATAGATGG + Intronic
1138547842 16:57729991-57730013 TGGATGGGCGAGTGGATAGATGG + Intronic
1138547925 16:57730322-57730344 TGGATGGGCGAGTGGATAGATGG + Intronic
1138547931 16:57730350-57730372 TGGATGGGCGAGTGGATAGATGG + Intronic
1139103757 16:63801683-63801705 TGTAAAGGGGAGGGAAGAGTGGG - Intergenic
1139426224 16:66881291-66881313 GGGGTGGGGGAGTGAAGGGACGG + Intronic
1139977360 16:70824327-70824349 TGAATGGGGGAAATAAGAGAAGG - Intronic
1140239813 16:73190821-73190843 TGTGTGGGGGAGAGCAGAGTGGG + Intergenic
1140337701 16:74125007-74125029 TGGAAGGGGGAGAGGAGAGAGGG - Intergenic
1142062978 16:88042558-88042580 TGGCTGGGAGAGGGAAGAGAAGG + Intronic
1142083488 16:88163702-88163724 TGGATGGGTGAGTGAATGGATGG + Intergenic
1142137760 16:88459551-88459573 AGGAGGGGGGAATGAAGAGAAGG - Intronic
1203019551 16_KI270728v1_random:388026-388048 TGTCTGTGGCAGTGAAGACAAGG - Intergenic
1203037886 16_KI270728v1_random:661184-661206 TGTCTGTGGCAGTGAAGACAAGG - Intergenic
1142996106 17:3761518-3761540 TATCTGTGGGAGGGAAGAGAGGG + Exonic
1143484113 17:7243546-7243568 GGTTTTGGGAAGTGAAGAGAGGG - Intronic
1143764286 17:9127349-9127371 TGTTTGTGGGAGCGAAAAGAAGG + Intronic
1144342615 17:14322709-14322731 TGAATGGGGGAGAGAGGACATGG - Intronic
1144697559 17:17315541-17315563 TGAATGGGCCAGTGAAGAGTCGG + Intronic
1145325648 17:21821775-21821797 TGAATGCAGGAGAGAAGAGAAGG + Intergenic
1146120997 17:30194842-30194864 CGTTTGGGGGAGAGAATAGATGG - Exonic
1147037392 17:37691915-37691937 TTTATGGGAAGGTGAAGAGAGGG - Intronic
1147588224 17:41665297-41665319 TGAGTGGGGGAGTGGACAGAGGG - Intergenic
1148562502 17:48613986-48614008 TATGGGGGGTAGTGAAGAGAGGG - Intronic
1148653731 17:49268002-49268024 GGTCTGGGGGAATGCAGAGAAGG + Intergenic
1148865402 17:50625785-50625807 AGCATGGGGGAGGGAAGACAGGG + Intronic
1149151233 17:53566332-53566354 AGTATAGGGGAGGTAAGAGAGGG + Intergenic
1150107196 17:62470910-62470932 GGAATGGGGGAGGGGAGAGAGGG + Intronic
1150215482 17:63466476-63466498 AGCATGGGGGTGGGAAGAGAAGG + Intergenic
1150568542 17:66364510-66364532 TGTATGGAGAAGAGGAGAGAGGG + Intronic
1151548929 17:74810136-74810158 TGAATGCGTGAGTGGAGAGACGG - Intronic
1151735495 17:75937550-75937572 TGTAAAGGTGAGTGGAGAGATGG - Exonic
1152468894 17:80480123-80480145 TGGGAGGGGGAGTGTAGAGAAGG + Intergenic
1152766984 17:82147142-82147164 TGGATGGGTGAGTGAAAGGATGG + Intronic
1153773275 18:8432499-8432521 TCTAGGGGAGAGTGGAGAGATGG - Intergenic
1154954951 18:21243891-21243913 TGTATGGAGGAGAGGAAAGAGGG - Intronic
1155531882 18:26775691-26775713 GGGATGGGGGCGTGGAGAGAAGG - Intergenic
1155649621 18:28125478-28125500 TGTATTGGGGAGGGAAAAAATGG + Intronic
1155897288 18:31346136-31346158 TCTATGAGGGAATGTAGAGAAGG + Exonic
1156534168 18:37846950-37846972 TATGTGGGGGATGGAAGAGAAGG + Intergenic
1156558292 18:38092225-38092247 GGTATAGGGGAGGGAAGAGAAGG + Intergenic
1156648692 18:39198816-39198838 TGTACGGGGGAGCCCAGAGAGGG - Intergenic
1156828392 18:41461592-41461614 TGTATTAGGGAGTAAGGAGAGGG + Intergenic
1156834960 18:41541603-41541625 GGTTTGGGGGAGACAAGAGAAGG + Intergenic
1157279369 18:46335579-46335601 TGTATGAGGGAGTGGGGAGAGGG - Intronic
1157847592 18:51017983-51018005 TGTAAGGGGCAGAGAAGGGAGGG - Intronic
1158073476 18:53500875-53500897 TGCATGGGAGGGTGGAGAGAGGG - Intronic
1158543965 18:58379934-58379956 TCTGTGGGGGAGTGAGGAGAGGG - Intronic
1158963374 18:62604234-62604256 TGTGTGGGGCAGGGGAGAGATGG + Intergenic
1159915004 18:74180796-74180818 TGTTTGGGAGAGTCAAGAAAAGG + Intergenic
1159961304 18:74557589-74557611 TATATGGGGGTGTGTAGGGATGG - Intronic
1160101191 18:75921217-75921239 TGAATGCAGGAGAGAAGAGAAGG - Intergenic
1160409815 18:78667893-78667915 TGGATGGGGGAAGGATGAGAGGG - Intergenic
1160692258 19:465512-465534 TGGATGGGTGAGTGGATAGATGG + Intronic
1160734080 19:653921-653943 TGCATGGGGGAGTGCTGTGAGGG + Intronic
1161287363 19:3475741-3475763 TGAATGGGTGGGTGAACAGATGG + Intronic
1161449250 19:4335418-4335440 TGGATGGGGGAGTGGATGGATGG - Intronic
1161899227 19:7105363-7105385 TGGATGGGTGGATGAAGAGAAGG + Intergenic
1163383668 19:16985793-16985815 TGGATGGAGGGATGAAGAGAGGG + Intronic
1163730463 19:18946448-18946470 TGGCTTGGGGAATGAAGAGAAGG - Intergenic
1164634929 19:29785152-29785174 TGGATGGGTGAGTGATTAGATGG + Intergenic
1164797428 19:31045230-31045252 TGTATGGATGAATGAATAGAAGG + Intergenic
1164804416 19:31105316-31105338 TCAATGAGGGAGTGCAGAGAAGG + Intergenic
1167610904 19:50507325-50507347 GGTCAGGGGGAGTGAAGTGATGG - Intronic
1168354160 19:55691730-55691752 TGTGGGGGAGAGAGAAGAGAAGG - Intronic
925045436 2:769868-769890 TTTAAGGATGAGTGAAGAGATGG + Intergenic
925512323 2:4641651-4641673 TGCAGGGGTGAGTGGAGAGAGGG + Intergenic
926049522 2:9735591-9735613 GGCAAGGGGGAGAGAAGAGAGGG + Intergenic
926555132 2:14348654-14348676 TGAAAGGGGGAAAGAAGAGAAGG + Intergenic
927437825 2:23085318-23085340 TGTGTGGGAAAGAGAAGAGAGGG + Intergenic
927570206 2:24152918-24152940 TGTAAAGGGGAGGGAAGAGTGGG - Intronic
927725306 2:25417683-25417705 GGTATGGAGGGCTGAAGAGAAGG + Intronic
927845097 2:26467312-26467334 TGTGTGGGGGCGGGAAGAGGGGG - Intronic
928893470 2:36234463-36234485 TGTATATGGGAGGGAAGGGAAGG - Intergenic
929860428 2:45672342-45672364 TGAATGGATGAATGAAGAGATGG - Intronic
930578810 2:53185079-53185101 AGTATAGGGGAGTGAGGAGAAGG - Intergenic
932128133 2:69163393-69163415 TGTGTGATGGAGTGAAGAAAAGG - Intronic
933234979 2:79854816-79854838 GAAATGGGGCAGTGAAGAGAGGG - Intronic
935468172 2:103424685-103424707 TGGGTGGGGGAGTGCAGTGATGG - Intergenic
935627022 2:105180049-105180071 TGTATGGGGGACAGAATAGCAGG + Intergenic
937113357 2:119384676-119384698 TGTATGTTGGAGTGAACAAATGG + Intergenic
937133671 2:119533436-119533458 TGTAGGAGGGAGAGAAGAGGAGG + Intergenic
939405007 2:141745406-141745428 TGGAAGGGGGAGGGAAGAGTAGG - Intronic
939558450 2:143705289-143705311 AGTATGTGGGAGTGACAAGAAGG - Intronic
940259942 2:151768967-151768989 AGTGTGGGGGAGGGAATAGAAGG + Intergenic
940562338 2:155314217-155314239 AATATGGGTGAATGAAGAGAAGG - Intergenic
941735078 2:168965294-168965316 AGTCTGGGGGAGGGAAGAGGAGG - Intronic
941883528 2:170505179-170505201 TGTAGGGGGGAGAGGGGAGAGGG + Intronic
942158987 2:173162293-173162315 TGTAGAGTGCAGTGAAGAGATGG + Intronic
942346699 2:175010432-175010454 TGTGTGTGGGTGTGAAGGGAGGG + Intergenic
943306431 2:186268217-186268239 TGAATGGGGGTGTTGAGAGAGGG - Intergenic
943445148 2:187975928-187975950 TTTCTGGGGGAGTGAAGTGGTGG + Intergenic
945879351 2:215310394-215310416 TATTTTGGGGAGTAAAGAGATGG + Intergenic
946016482 2:216608051-216608073 GTTATGGGGGTCTGAAGAGAAGG + Intergenic
948347746 2:237313305-237313327 GGGGTGGGGGATTGAAGAGATGG - Intergenic
1169466007 20:5839441-5839463 TGAATGGGTAAATGAAGAGATGG + Intronic
1170015844 20:11781082-11781104 TGTATGGGGCAGGGAGCAGAGGG + Intergenic
1170700690 20:18700756-18700778 TGTCTGGGGAAGTGAAGACTTGG + Intronic
1172035956 20:32010846-32010868 TGTTTGGGGCAGTGACGAGCAGG - Intronic
1174005190 20:47405029-47405051 AGGATGGCAGAGTGAAGAGATGG - Intergenic
1174247093 20:49189312-49189334 TGTATGGGAGGTTGGAGAGAGGG + Intergenic
1174357063 20:50005641-50005663 TGTTTGGGGTATTGAAGAAATGG + Intergenic
1175484174 20:59333281-59333303 TTTATGGGGGAGTGGTGGGAGGG - Intergenic
1175772603 20:61633050-61633072 TGGATGGGTGAATGAAGAGATGG - Intronic
1175817285 20:61889875-61889897 TGGATGGGTGAGTGAATGGATGG + Intronic
1175817846 20:61892951-61892973 TGGATGGGTGGGTGAATAGAGGG + Intronic
1175817889 20:61893113-61893135 TGGATGGGTGGGTGAATAGAGGG + Intronic
1175817951 20:61893350-61893372 TGAATGGGTGGGTGAATAGAGGG + Intronic
1175817971 20:61893433-61893455 TGGATGGGTGGGTGAATAGAGGG + Intronic
1176661925 21:9644901-9644923 AGTAAGGAGGAGTGAAGAGCAGG + Intergenic
1176673522 21:9755786-9755808 TGTTTGGGGTAGTGACGGGAAGG + Intergenic
1176864667 21:14039591-14039613 TGTATGTGGGGGAGTAGAGAAGG - Intergenic
1176953774 21:15075719-15075741 TATATGGGGGATTGAAGGGAAGG + Intergenic
1177827435 21:26100056-26100078 TGTGGGTGGGAGGGAAGAGATGG + Intronic
1177849888 21:26333503-26333525 TGGAAGGGGGAAAGAAGAGAGGG + Intergenic
1179019434 21:37625118-37625140 TGTGTTGGGGGGAGAAGAGAAGG + Exonic
1179025875 21:37677877-37677899 TGTATGAATGAGTGAACAGAAGG - Intronic
1181004963 22:20008922-20008944 TGGAGGGGGGAGGGAAAAGAAGG + Intronic
1181363307 22:22355261-22355283 TTTATGGAGGAATGAGGAGATGG + Intergenic
1181366185 22:22378710-22378732 TTTATGGGGGAATGAGGGGACGG + Intergenic
1181458218 22:23071215-23071237 TGTTTGGGGGAGGGGAGTGAGGG + Intronic
1181851864 22:25755131-25755153 GGGATGGGGGAAAGAAGAGAAGG - Intronic
1182013270 22:27018346-27018368 TATATGTGTGAGTGAATAGAAGG - Intergenic
1182109334 22:27711679-27711701 AATATGGGGGAGAGAAAAGAAGG + Intergenic
1183247540 22:36705330-36705352 TTTTGGGGGGAGTGGAGAGAAGG + Intergenic
1183738679 22:39658011-39658033 TGCATGGGGCAGTGGGGAGACGG + Intronic
1184169869 22:42752486-42752508 TGGAAGGGGAAGTGAGGAGAGGG + Intergenic
1184460854 22:44637050-44637072 TGGATGGGTGATTGAACAGAGGG + Intergenic
1184541339 22:45127439-45127461 TTTTTGGGGGGGTGAGGAGATGG + Intergenic
1184541946 22:45131953-45131975 TGAATGGGGAAGTGAGGACAAGG - Intergenic
1184600482 22:45540489-45540511 GGTATGGGGGAACAAAGAGAGGG - Intronic
1184609677 22:45594735-45594757 TGGATGGGTGAGTGGATAGATGG + Intronic
1184964637 22:47962227-47962249 TGTATGGGTGGGTGAATGGATGG + Intergenic
1185303983 22:50102031-50102053 TTGATGGGGCAGAGAAGAGAAGG + Intronic
949221753 3:1642867-1642889 TGAGAGGGGAAGTGAAGAGAGGG + Intergenic
950474233 3:13205642-13205664 TGGATGGAGGGGTGAAGAGATGG - Intergenic
951865862 3:27306516-27306538 TGTATGTGGGAGTGAGGTGGGGG - Intronic
952015929 3:28957925-28957947 GGTTTGGGGGAATGGAGAGAAGG - Intergenic
952979074 3:38720701-38720723 TGGACCGGGGTGTGAAGAGAAGG + Intronic
953787513 3:45922147-45922169 TGTATGGTGGTGTGAGGAGCAGG + Intronic
954691901 3:52400128-52400150 TGTATTGGGGACTGAAGATAGGG - Intronic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
955218130 3:57001731-57001753 GGGATGGCGGAGTGAAAAGAAGG + Intronic
955411085 3:58655929-58655951 TGAATGGATGGGTGAAGAGATGG - Intronic
956557080 3:70536043-70536065 AGGATGGAGGAGTGGAGAGATGG - Intergenic
956854524 3:73262989-73263011 TGTATACAGGATTGAAGAGATGG + Intergenic
956877943 3:73481900-73481922 TGTGTGGGGGTGCGAAGGGATGG - Intronic
957071625 3:75572069-75572091 TGTATGGGGAAGAGATAAGAGGG - Intergenic
957803277 3:85114204-85114226 TGGATGGGGGACTGGGGAGAGGG + Intronic
958709575 3:97700991-97701013 TGTGTCAGAGAGTGAAGAGAAGG + Intronic
960645109 3:119871675-119871697 TGGAAGGGGGAGTAGAGAGAGGG + Intronic
961125056 3:124409889-124409911 TGCCTGGGGGAGAGAAGGGAGGG + Intronic
961282510 3:125775017-125775039 TGTATGGGGAAGAGAAAGGAGGG + Intergenic
961572119 3:127806614-127806636 TGTATGGGTGGGTGGATAGATGG + Intronic
962406939 3:135108708-135108730 TGAAGGGGGGAGAGAAAAGAAGG - Intronic
962467605 3:135674708-135674730 TGGATGTGGGAGAGAGGAGATGG + Intergenic
962471242 3:135711181-135711203 GGTAAGTGGGAGTGAAAAGAGGG - Intergenic
963339471 3:144017461-144017483 TGAAAAGTGGAGTGAAGAGATGG - Intronic
965748980 3:171957139-171957161 TGTGTGGGCTAATGAAGAGAGGG - Intergenic
966916934 3:184589970-184589992 TGAATGGGTGAATGAATAGATGG + Intronic
967339917 3:188385344-188385366 TGTGGGGGGGTGTGAAGAGAGGG + Intronic
969015217 4:4099380-4099402 TGTATGGGGAAGAGAAAGGAGGG - Intergenic
969110835 4:4843257-4843279 TGGATGGGTGGGTGGAGAGACGG + Intergenic
969589680 4:8114706-8114728 TTAATGGGGGATTGAACAGAGGG - Intronic
969675972 4:8614579-8614601 TGTATGGGGCAGTGAGGCTACGG - Intronic
969718651 4:8880974-8880996 TGTGTGGGGGTGTGGAGGGATGG - Intergenic
969738717 4:9008871-9008893 TGTATGGGGAAGAGAAAGGAGGG + Intergenic
969784963 4:9449948-9449970 TGAATCAGAGAGTGAAGAGAAGG - Intronic
969797921 4:9540516-9540538 TGTATGGGGAAGAGAAAGGAGGG + Intergenic
970145961 4:13036000-13036022 TGTATGGAGGGGAGAGGAGAGGG - Intergenic
970250124 4:14105705-14105727 TTTTAGGGGGAGTGAAGAAAAGG + Intergenic
971000425 4:22316560-22316582 TGTTTGGGGCAGTGGAGAAATGG - Intergenic
971983313 4:33784983-33785005 TGTATCGGGGAGTGGGGAGGTGG - Intergenic
973200918 4:47501189-47501211 AATATGGGGCAGTGAAAAGATGG + Intronic
975967840 4:79996550-79996572 TGTGTGGCAGAGTGGAGAGAGGG - Intronic
976119205 4:81761492-81761514 TGGAAGGGAGAGAGAAGAGAAGG - Intronic
976299774 4:83506813-83506835 GGTCTGGGAGAGTGAGGAGAGGG + Intronic
977108735 4:92922476-92922498 TTTCTGGGGGGGTGGAGAGATGG - Intronic
977559727 4:98520115-98520137 TGTATGGGGCAGTGTACAGAGGG + Intronic
977922424 4:102660216-102660238 TGAATGTGGGAGGTAAGAGAGGG - Intronic
978501242 4:109412084-109412106 TGGATTGGGGAGTGGAGACATGG + Intergenic
979002701 4:115245243-115245265 TTTATTGGAGAGTGAAAAGAGGG - Intergenic
980516314 4:133867101-133867123 TTTCTGGGGTAGTGAAGAGAAGG - Intergenic
981073003 4:140564817-140564839 TTGATTGGGAAGTGAAGAGAGGG - Intronic
982013303 4:151127379-151127401 TGTATGGGGGTGTAAAGCCAAGG + Intronic
982198662 4:152938570-152938592 TGTATTTGGGAGAGAAGAAAAGG - Intronic
982563939 4:156965671-156965693 TGGCTGGGGGAGTGATGAGATGG - Intronic
984563604 4:181300899-181300921 TGAATGTGGGAATGAAGAAAAGG - Intergenic
985413470 4:189711645-189711667 AGTAAGGAGGAGTGAAGAGCAGG - Intergenic
986176606 5:5357909-5357931 TGTTTTTGGGAGTGAAGAGTTGG - Intergenic
986437494 5:7748238-7748260 TGTGTGGGTGAGAGAAGGGATGG + Intronic
988297806 5:29389370-29389392 TGTGAGGAGGAGTGAAGAAAAGG + Intergenic
988358783 5:30209297-30209319 TGGATTGGGGTATGAAGAGATGG + Intergenic
989205441 5:38804991-38805013 TGTATGGGGCAGGGAAGGGAAGG - Intergenic
989520444 5:42394771-42394793 TGGATGGGGGAGGAAGGAGAGGG - Intergenic
989700441 5:44257826-44257848 TATATGGGGGATTGAAAATAAGG + Intergenic
990114684 5:52374458-52374480 TGTATGGAGGAGTGAAAGGGTGG - Intergenic
990244244 5:53848191-53848213 TGTAAGGGAGGGAGAAGAGAGGG - Intergenic
990908016 5:60824207-60824229 TCTCTGAGAGAGTGAAGAGAAGG + Intronic
991152184 5:63383262-63383284 TGTGTGGGTGGGTGAAGAGGAGG + Intergenic
992579073 5:78152027-78152049 GGGAAGGGGGAGGGAAGAGAAGG - Intronic
993869838 5:93239729-93239751 TGTATGGGGGTGTGAACTGCAGG - Intergenic
993956758 5:94243723-94243745 TGTGTGGGGCAGGGAAGGGAGGG - Intronic
995057518 5:107776654-107776676 TGTGTGGGGGCGTGGAGAAAGGG - Intergenic
995303285 5:110611430-110611452 GGTGTGGGAGAGTGAAGGGATGG + Intronic
995360787 5:111294111-111294133 TGAATGGGTGAGTGAATAAATGG - Intronic
995401509 5:111747509-111747531 GGGATGGGGGAGAGAAGAGCTGG + Intronic
995544058 5:113212703-113212725 GGTGTTGGGGAGTGAATAGAAGG - Intronic
995580936 5:113601461-113601483 TGTAGGGGGAAGAGAAGAGGAGG - Intergenic
996452582 5:123642289-123642311 TGTATGAGGGAGGTAAGAAAGGG + Intergenic
997607343 5:135184693-135184715 GGTATTGGGGAGTGTAGTGAAGG - Intronic
998158817 5:139801592-139801614 TGTATGGAGGAGTGGAGATGGGG - Intronic
998411868 5:141917328-141917350 AGTATTGGGGAGGGCAGAGAAGG + Intergenic
998852000 5:146360006-146360028 TGGAAGTGGGAGTGAAGATAAGG - Intergenic
999745477 5:154588618-154588640 TGTATGGAGGGCTGAGGAGAGGG - Intergenic
1000050810 5:157561523-157561545 TGTATGGGGAAATGTACAGAGGG + Intronic
1000167717 5:158671141-158671163 TGTATGGGAGAGTTAACAAAGGG - Intergenic
1000259767 5:159576384-159576406 TGGATGGCCAAGTGAAGAGATGG + Intergenic
1000361801 5:160454461-160454483 TCTATGGGGGTGGGAAGAGGGGG + Intergenic
1001930850 5:175672049-175672071 TGTGTGGAGGGGTGAAGGGAAGG - Intronic
1002067607 5:176659985-176660007 TGGATGGATGAGTGAATAGATGG - Intergenic
1002364416 5:178698971-178698993 TGTCTGTGGAAATGAAGAGATGG - Intergenic
1003285230 6:4728402-4728424 AGGATGGGGGAGTGAAGAGGAGG - Intronic
1003431027 6:6037649-6037671 TGTTGGGGGGTGTGAAGAGCGGG - Intergenic
1003592883 6:7450417-7450439 TGTAGGAGGGAGAGGAGAGAAGG + Intergenic
1003612795 6:7628672-7628694 GGAAGTGGGGAGTGAAGAGAGGG + Intergenic
1003776205 6:9368422-9368444 TGTGTGGGGGGGTGCAGAGAGGG - Intergenic
1005098634 6:22145742-22145764 TGTAGGGAGAAGAGAAGAGATGG - Intergenic
1005277464 6:24235244-24235266 TGAATGGGGGAGATAAGACATGG + Intronic
1005294987 6:24416839-24416861 TACATGGGGGAGGGAAAAGATGG + Intronic
1006252394 6:32798744-32798766 TGTATATGGGAGAGAGGAGAAGG + Intergenic
1006287170 6:33105452-33105474 TGGGTGGGTGAGTGAATAGATGG + Intergenic
1006297576 6:33176808-33176830 TGTAGGGAGGGGTGCAGAGAGGG - Intronic
1006432798 6:34008110-34008132 TGGAGGGCGGAGTGAAGTGAGGG - Intergenic
1007395940 6:41577899-41577921 TGTTTGGGGCAGTAAGGAGAAGG - Intronic
1007994441 6:46291356-46291378 GGTAGGGGGAAGTGAGGAGAAGG + Intronic
1008198612 6:48557980-48558002 TCTATGGGGAAGTGGAGAGATGG + Intergenic
1008397027 6:51020871-51020893 GGTATGGGGCTTTGAAGAGATGG - Intergenic
1008628287 6:53339079-53339101 TGTGAGGGTGAGTGAGGAGAGGG + Intronic
1008811941 6:55513058-55513080 GGTATGGGGGAGGGAGGAGAGGG - Intronic
1009809413 6:68640724-68640746 TGTAAGGGGAAGTGGAGGGATGG + Intronic
1010397895 6:75412861-75412883 TGTGGGAGGCAGTGAAGAGAAGG - Intronic
1012079302 6:94735781-94735803 TGTAGGGGAGAGTGAAAAGCAGG + Intergenic
1014121904 6:117735628-117735650 TGTATGTGGAGGTGAAGAGCAGG + Intergenic
1016491310 6:144606925-144606947 TGTAAGGAGGAGAGAAGTGAGGG + Intronic
1016507543 6:144799543-144799565 TGTATGGGAGAGGGAATAGCTGG + Intronic
1017540871 6:155401178-155401200 GGTAGGGGGGATTGGAGAGATGG - Intronic
1017582383 6:155880290-155880312 TGTTTGGTGCAGTGCAGAGAGGG + Intergenic
1018212987 6:161500211-161500233 TGTATAGGGGAGAGGGGAGAGGG - Intronic
1018336174 6:162792312-162792334 AGTAAGGGGCAGGGAAGAGAAGG + Intronic
1018676450 6:166226376-166226398 TGGATCAGGGAGTGAGGAGAGGG + Intergenic
1018846726 6:167561954-167561976 TGTATGGGTGAGGGAATATATGG - Intergenic
1019510584 7:1415556-1415578 TGGATGGGTGGGTGAATAGATGG + Intergenic
1021124372 7:16833820-16833842 TGTACGGGGGAGCTAGGAGAGGG + Intergenic
1021275877 7:18650233-18650255 TGTATGTGGGAGGGAAGATTAGG + Intronic
1021920856 7:25483553-25483575 TGGATGGGAGAGGGCAGAGATGG + Intergenic
1022642731 7:32203521-32203543 TGGATGGGGGAGTGAAGCAAGGG - Intronic
1023139433 7:37086355-37086377 TGTGTGTGTGTGTGAAGAGAAGG + Intronic
1024488466 7:49947922-49947944 AGAATAGGGGAGTGAAGAGTGGG - Intronic
1024662368 7:51510763-51510785 TGTAAAGGGGAGGGAAGAGTGGG - Intergenic
1026211380 7:68308799-68308821 TGTATAGGGGAGTGAAAAAGAGG + Intergenic
1026420331 7:70230203-70230225 GGTATGTGTGAGGGAAGAGATGG - Intronic
1027722880 7:81767593-81767615 TGTAGGTGGGAGTGAATAGAGGG + Intronic
1029073893 7:97921041-97921063 TGTATGGGGAAGAGAAAGGAGGG - Intergenic
1029238389 7:99142662-99142684 AGGATGGGGGAGTGAGAAGAGGG + Intronic
1029504307 7:100953029-100953051 GGTAGGGGGAAGTGAGGAGATGG - Exonic
1030400226 7:109040159-109040181 TGGATGGTGGAGTGGAGGGATGG + Intergenic
1030730816 7:112986326-112986348 AGCATGGGGCAGTGAGGAGAGGG + Intergenic
1031431894 7:121681976-121681998 TGTATGAGGGAATGAATAAAAGG + Intergenic
1031928376 7:127660111-127660133 TGAATGGTGGGGTGGAGAGAGGG + Intronic
1033928061 7:146488549-146488571 TGAATGGTTGAATGAAGAGAAGG - Intronic
1035001309 7:155614628-155614650 TGTATGGGGCATTGGAGGGATGG + Intronic
1035279032 7:157765795-157765817 TGGATGGGTGAGTGAATGGATGG - Intronic
1035345746 7:158196561-158196583 CTCATGGGGAAGTGAAGAGACGG - Intronic
1035770174 8:2140756-2140778 AATCGGGGGGAGTGAAGAGATGG + Exonic
1036243812 8:7100255-7100277 TGTATGGGGAAGAGAAAGGAGGG + Intergenic
1036256977 8:7213796-7213818 TGTATGGGGAAGAGAAAGGAGGG - Intergenic
1036309027 8:7672395-7672417 TGTATGGGGAAGAGAAAGGAGGG - Intergenic
1036360507 8:8073717-8073739 TGTATGGGGAAGAGAAAGGAGGG + Intergenic
1036727138 8:11230366-11230388 TGCATGGGGGTGTGGAGAGAAGG + Intergenic
1036890464 8:12593250-12593272 TGTATGGGGAAGAGAAAGGAGGG - Intergenic
1036898032 8:12651168-12651190 TGTATGGGGAAGAGAAAGGAGGG - Intergenic
1037424848 8:18744382-18744404 TGGATGGCAAAGTGAAGAGAAGG - Intronic
1038325814 8:26571996-26572018 TGAATGCGGCAGTAAAGAGAAGG - Intronic
1038476940 8:27875213-27875235 AGGAGGGAGGAGTGAAGAGAGGG - Intronic
1039412655 8:37368324-37368346 TGAATGGAGGATGGAAGAGAAGG + Intergenic
1041189051 8:55334594-55334616 TGAAGTTGGGAGTGAAGAGAGGG - Intronic
1041240222 8:55842765-55842787 GGTATGGGGGAGTGAAGCACAGG - Intergenic
1041340979 8:56845100-56845122 GGGATGGGGGAGTGAGCAGATGG + Intergenic
1041668320 8:60467455-60467477 TGGATGAGGCAGTAAAGAGAGGG + Intergenic
1042466024 8:69130902-69130924 TGCATGGTGGAGTGTGGAGAAGG - Intergenic
1043851686 8:85223573-85223595 TGTGTGGTGGAGAGAAGAGATGG - Intronic
1044724610 8:95183072-95183094 TGTTTGGGGCAGGGAATAGATGG + Intergenic
1044898814 8:96922591-96922613 TATATGGGGTAGTGAAGAGCAGG - Intronic
1045037790 8:98189787-98189809 TGTGTGGGGTATTGAAGAGGGGG + Intergenic
1045325765 8:101116603-101116625 TGTCAAGGGGAATGAAGAGAGGG + Intergenic
1046187291 8:110738280-110738302 TGCATCTGGAAGTGAAGAGATGG - Intergenic
1047527355 8:125644949-125644971 TGAAAGGGAGAGTGAGGAGAAGG - Intergenic
1048088648 8:131213639-131213661 TGGATGGGGGAAGGAAGGGAGGG + Intergenic
1048290659 8:133178976-133178998 TGGATGGAGGAGAGAAGGGAGGG - Intergenic
1050039162 9:1470765-1470787 TGTGTGTGTGTGTGAAGAGAGGG - Intergenic
1050457897 9:5850965-5850987 TGGATGGGGGATTGAATTGAGGG - Intergenic
1051464901 9:17366696-17366718 TGTGTGGCAGAGAGAAGAGAAGG + Exonic
1051698092 9:19789880-19789902 TGGATGGGGGAGAGAACAGAAGG - Intergenic
1052214581 9:25950940-25950962 TGTAAAGGGGAGGGAAGAGTGGG - Intergenic
1052457374 9:28717540-28717562 TGTGTGGGAGAGAAAAGAGAGGG - Intergenic
1052574226 9:30271095-30271117 TGCATAGGTGACTGAAGAGATGG - Intergenic
1052772076 9:32699065-32699087 TGTGCGGGTGAGTGAAGGGAAGG - Intergenic
1053351725 9:37417705-37417727 GCTATGGGGGAGAGAAGTGAGGG + Intergenic
1053425120 9:38005280-38005302 TGAAAGGGAGAGTGAAGAGGTGG + Intronic
1054972226 9:71101464-71101486 TGTATGTGTAAGTGAAGACAGGG + Intronic
1055644672 9:78351707-78351729 TGTAGTAGGGAGTGAACAGAGGG - Intergenic
1057077078 9:92143538-92143560 AGAATGGCGGAGAGAAGAGAGGG + Intergenic
1057238149 9:93382748-93382770 CATATGGAGGAGTGAAGATAAGG + Intergenic
1057980901 9:99662173-99662195 TGTAGGGCCAAGTGAAGAGATGG - Intergenic
1058591642 9:106571678-106571700 AGGATGGTGGAGGGAAGAGATGG - Intergenic
1058615962 9:106827933-106827955 TGAATTGGGGAGGGAAGGGAAGG + Intergenic
1058643600 9:107110146-107110168 TTGATGGGGGAGTGATGATATGG - Intergenic
1059448021 9:114351097-114351119 TGATGGGGGAAGTGAAGAGACGG + Intronic
1059498541 9:114730922-114730944 TGGATGGGCGGGTGAAAAGATGG - Intergenic
1059788776 9:117616996-117617018 TATAGGAAGGAGTGAAGAGAGGG - Intergenic
1060860843 9:126953774-126953796 AGAATGAGGGAGTGAACAGAAGG + Intronic
1061306364 9:129735476-129735498 GGTGCGGGGGAGAGAAGAGAGGG - Intergenic
1061357964 9:130120609-130120631 TGGATGGGGCAGTGAACAGCAGG - Intronic
1061387682 9:130300063-130300085 TGGATGGGTGAGTGGATAGATGG - Intronic
1203639486 Un_KI270750v1:146744-146766 AGTAAGGAGGAGTGAAGAGCAGG + Intergenic
1185613330 X:1405094-1405116 TGGATGGATGAGTGAACAGATGG + Intronic
1185624830 X:1474211-1474233 TGGATGGGAGGGTGAATAGATGG + Intronic
1185632592 X:1525959-1525981 TGAATGGGTGAGTGAATAGTGGG - Intronic
1185632638 X:1526381-1526403 TGAATGGGTGAGTGAATAGTGGG - Intronic
1185639267 X:1577697-1577719 TGGATGGATGAGTGAATAGATGG + Intergenic
1185719705 X:2371920-2371942 TGTCTGGGGCAGGGAAGATATGG - Intronic
1185750441 X:2606852-2606874 TGGATGGATGAGTGAATAGATGG - Intergenic
1186765751 X:12769082-12769104 AGTAGGGGGTAGGGAAGAGAAGG + Intergenic
1188651256 X:32634087-32634109 TGGAAAGGGGAGAGAAGAGAGGG - Intronic
1188786096 X:34348484-34348506 TGGATGGGTGAGTGGAAAGATGG - Intergenic
1190116230 X:47627639-47627661 TCTCTGTGGGAGAGAAGAGAGGG + Exonic
1190598455 X:52067895-52067917 TGAATGGGGGAGGGAGGAGGGGG - Intronic
1190610369 X:52186178-52186200 TGAATGGGGGAGGGAGGAGGGGG + Intronic
1190873085 X:54440811-54440833 TGTGTGGGGGTGTGGAGAGGAGG + Intronic
1190909733 X:54759672-54759694 AGGATGGGGGAATGAAGAGAGGG + Intronic
1192081228 X:68049793-68049815 AGAATGTGGGAGTGAAAAGAGGG - Intronic
1192206209 X:69098160-69098182 AGGATGGGGCAGTGGAGAGATGG - Intergenic
1193596368 X:83451279-83451301 TGGAAAGGGGAGGGAAGAGAGGG - Intergenic
1193925181 X:87475927-87475949 TGAAAAGGGGAGGGAAGAGAAGG - Intergenic
1194989408 X:100530038-100530060 GGTATGGGGGAAAGAGGAGATGG - Intergenic
1195069409 X:101264550-101264572 TATTTGGGGGTGGGAAGAGAGGG + Intergenic
1196134789 X:112197245-112197267 TGTTAGGTGGAGTGAAGAGAGGG + Intergenic
1198142173 X:133815269-133815291 TGTATGGAGGAGGAAAGAGATGG - Intronic
1198142410 X:133817682-133817704 TGTATGGAGGAGGAAAGAGATGG + Intronic
1199704563 X:150412657-150412679 TGGATGGGGCGGGGAAGAGAGGG - Intronic
1200071580 X:153531917-153531939 TTTATGGAGGAGAGAACAGATGG - Intronic
1200315936 X:155133008-155133030 TGGAAGGGGGAGGGAAGAGTGGG + Intronic
1201305916 Y:12550421-12550443 TGGATGGGGGAGTGAGAAGAAGG + Intergenic