ID: 1137575140

View in Genome Browser
Species Human (GRCh38)
Location 16:49594384-49594406
Sequence TCCCTCTGTTGAGAGAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137575140 Original CRISPR TCCCTCTGTTGAGAGAGGCC TGG (reversed) Intronic
900373455 1:2342738-2342760 TGGCTCTGCTGAGGGAGGCCAGG - Intronic
901214359 1:7547302-7547324 TCTATCTACTGAGAGAGGCCTGG - Intronic
901497889 1:9632528-9632550 TTCCTCTGTTGAGAGGATCCTGG - Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902573021 1:17359122-17359144 CCCCTCTGTGCAGTGAGGCCTGG + Intronic
903352646 1:22727268-22727290 TCCAGCAGTTGGGAGAGGCCAGG + Intronic
903780707 1:25818420-25818442 GCTCTCTGTTGAGAGAGATCTGG + Intronic
904251114 1:29224970-29224992 TCCCTCCGTCCAGAGAGTCCGGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915517075 1:156419938-156419960 TCCCGCTGGAGGGAGAGGCCTGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915900105 1:159840650-159840672 TCCTTCTGCTGGGAGTGGCCAGG - Intronic
919709133 1:200708864-200708886 TTCCTCTGCTGGGAGATGCCAGG + Intergenic
920512363 1:206560507-206560529 TGCCTCCTTTGAGAGGGGCCGGG + Intronic
920879894 1:209870012-209870034 TCTCTCTGGTGAGAGAAGCCAGG + Intergenic
921132545 1:212232210-212232232 CCCCTCTGGGGAGGGAGGCCCGG - Intergenic
922230204 1:223679208-223679230 TTCCTCTTTTGAGAGTGGGCTGG - Intergenic
1064440242 10:15346905-15346927 TCCCTCTGTAGAAAGTGGCTCGG - Intronic
1065048230 10:21763472-21763494 TCCCTCTGTGGAAGGGGGCCAGG + Intronic
1067455623 10:46417443-46417465 TGCCTCTGGAGAGTGAGGCCAGG + Intergenic
1067578315 10:47421340-47421362 TCCTTGTGCTGAGACAGGCCTGG - Intergenic
1067631580 10:47967196-47967218 TGCCTCTGGAGAGTGAGGCCAGG - Intergenic
1067804586 10:49384151-49384173 TCCCACTTCTGAGAGAGGCCTGG - Intronic
1073571560 10:104584735-104584757 TTCCTCTGTTGAGGGAGACGTGG + Intergenic
1073676448 10:105652363-105652385 TCCTTCTCTTAAAAGAGGCCAGG + Intergenic
1074437340 10:113445273-113445295 TCCCTCTGTTGAGAAAGGTTAGG - Intergenic
1075072587 10:119328574-119328596 TCCCTCTTTTGGGAGAAGCTGGG - Intronic
1075161635 10:120029578-120029600 TCTCTCTGTTGAGGCAGGGCAGG - Intergenic
1075267974 10:121021635-121021657 TGCCTCTGGTGATGGAGGCCAGG + Intergenic
1075444196 10:122502561-122502583 TCCCTCTGTTGAGAGACTTCTGG + Intronic
1075507125 10:123033887-123033909 GCCCTGTGCTGAGAGAGCCCAGG - Intronic
1076910410 10:133385323-133385345 TCCAGGTGTTGAGATAGGCCTGG + Intronic
1077212880 11:1381655-1381677 TCTTCCTGTTGAGAGAAGCCAGG - Intergenic
1078583465 11:12558566-12558588 TCCCTCTGCAGAGAGAGGAGAGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1083498850 11:63084397-63084419 TCCCTCTGTGGAAAGAGGAAAGG + Intronic
1083550973 11:63590034-63590056 TCCCTCTGCTGACGGAGGCTGGG - Intronic
1084288600 11:68147400-68147422 TCCCACTGTACAGAGAGGCAGGG - Intergenic
1085741045 11:79078687-79078709 TCTCACTGTTGAAAAAGGCCAGG - Intronic
1087257613 11:95974154-95974176 TCCATGTGTTGAGAGGGACCTGG + Intergenic
1088900661 11:114114458-114114480 TCCCTCTATTGAGCTAAGCCTGG - Intronic
1089699579 11:120236378-120236400 TCCAGCTGTTGAGAGAGGTGGGG + Intergenic
1090679720 11:129041923-129041945 TCCCTCTGTTGACAGACTCTGGG + Intronic
1092151189 12:6249984-6250006 TCCCTCTGCTGGGAGAAGCCAGG - Intergenic
1092436925 12:8456080-8456102 TCCCTGTGTTGAGAAGGTCCAGG - Exonic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097175882 12:57142764-57142786 CCCCTCTGTGGAGAAAGGCTGGG + Intronic
1100803644 12:98258969-98258991 TGGGTCTGTTGAAAGAGGCCTGG + Intergenic
1101646341 12:106634102-106634124 TCCCTCTGTTGAGAGGAGCTTGG + Intronic
1102047211 12:109836925-109836947 TCCCAATGTTTTGAGAGGCCAGG - Intergenic
1102346414 12:112163824-112163846 ATCCTCTCTTGGGAGAGGCCTGG + Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1105572839 13:21620303-21620325 GCCCTCTGCTGAGGGAGGCAGGG - Intergenic
1105728622 13:23189087-23189109 TCCCTGTGTAGTGAGAGGACGGG - Intronic
1105906609 13:24816949-24816971 TCTCTCTCTGGAGAGTGGCCAGG - Intronic
1106720491 13:32430142-32430164 TCCCTCTGTTAAGAGGTCCCAGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1107960549 13:45554359-45554381 TCCATCTGTTGATAGAGACTTGG + Intronic
1108393848 13:49974113-49974135 TTCAGCTGTTAAGAGAGGCCTGG - Intergenic
1108496849 13:51033911-51033933 TGCCTCTGTTGGGGGAGGCGGGG + Intergenic
1110253641 13:73408177-73408199 TCTTTCTGTAGAGAGAGGCTAGG + Intergenic
1111642917 13:90993651-90993673 TGCCTCTGTTGTGAGCAGCCAGG - Intergenic
1118787891 14:69061456-69061478 TCCTTCTGTGGACACAGGCCAGG + Intronic
1119599145 14:75963220-75963242 ACCCTCTGTTGAGTGTGGCTTGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1124581847 15:30962817-30962839 TCTCGCTGCAGAGAGAGGCCGGG + Intronic
1128373441 15:67058112-67058134 TCCATCTGTTGACAGATGCTTGG + Intergenic
1129263439 15:74381695-74381717 CTCCTGTGGTGAGAGAGGCCTGG - Intergenic
1130018972 15:80211115-80211137 TGCCTCTGTGGAGCCAGGCCAGG + Intergenic
1131363867 15:91820649-91820671 TCTCTCTGTTGACGGATGCCAGG + Intergenic
1132544330 16:526400-526422 CCCCTCTGTGGAGACAGGCAGGG - Intergenic
1133091190 16:3404993-3405015 CTCCTCTGTTTAGAGGGGCCTGG + Intronic
1133718909 16:8475788-8475810 TCTCTCTGCTGATAGAGTCCAGG - Intergenic
1134661446 16:15987534-15987556 GCACTCTGTGGACAGAGGCCAGG - Intronic
1137535006 16:49314010-49314032 TCCTACTGTTGAGGGAGGCATGG + Intergenic
1137537799 16:49340624-49340646 TCCATCTGTTCGGGGAGGCCTGG + Intergenic
1137575140 16:49594384-49594406 TCCCTCTGTTGAGAGAGGCCTGG - Intronic
1137852442 16:51759561-51759583 TCCCCCTGGTGACAGAGGGCAGG - Intergenic
1138587404 16:57979479-57979501 TCCCGCTTCTGAGAGAAGCCAGG + Intronic
1139484413 16:67247822-67247844 TCCCTCAACTGAGAGAGACCTGG - Intronic
1140427929 16:74876075-74876097 TCCCTCTGTTGTAAGAGGGAAGG - Intronic
1141356495 16:83351438-83351460 TCTCTCTGTGTAGAGATGCCAGG - Intronic
1141640409 16:85337720-85337742 GCCCTGTGCTGAGAGAAGCCCGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145908780 17:28530895-28530917 AGCCTCTGCTCAGAGAGGCCTGG - Intronic
1147733318 17:42617869-42617891 CCCCTCTGTTCATAGGGGCCTGG - Intergenic
1150589467 17:66549452-66549474 TCAATCTCTTTAGAGAGGCCTGG - Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152960943 18:79868-79890 CCCCTCTTCTCAGAGAGGCCAGG + Intergenic
1155023114 18:21914739-21914761 TCCCAGTGTTTAGGGAGGCCAGG - Intergenic
1155548509 18:26940084-26940106 TCCCCTTATTGAGAGAGGTCAGG - Intronic
1157296249 18:46447403-46447425 TCCCTCTGAAGAGAGAGGAAAGG + Intronic
1157562520 18:48658934-48658956 TAACTCTGTTGCGTGAGGCCTGG + Intronic
1157596933 18:48869761-48869783 TCTCACTGTCTAGAGAGGCCTGG + Intergenic
1158253223 18:55513948-55513970 TCCCTTTGTATAGAGAAGCCTGG + Intronic
1159706466 18:71695609-71695631 TCCCTCTGATGAGAATGGCCTGG - Intergenic
1159716192 18:71826388-71826410 TCCCTCAGTTGAGAGTTGTCTGG + Intergenic
1161256838 19:3314452-3314474 TCACTTAGTTGAGAGTGGCCTGG + Intergenic
1161344442 19:3761127-3761149 TCCATTAGTTGAGAGAGGTCTGG - Intronic
1161773575 19:6244446-6244468 GCCCACTGTTGAGAGAGGCGGGG - Intronic
1162369546 19:10270598-10270620 TCCCTCAGTGGAGGGAGCCCGGG + Intergenic
1163270093 19:16247876-16247898 TCGCTGTGTTCAGAGAGGGCTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163586503 19:18167214-18167236 TCTCTCTGTTGTCCGAGGCCTGG - Exonic
1163680956 19:18682306-18682328 TCCCTCTCTTGAGGGAGGGAGGG + Intergenic
1163803843 19:19384687-19384709 TCCTTCTCTGGAGAGAGGCGAGG + Intergenic
1164084201 19:21886846-21886868 CCCCACTGTTTAGAGGGGCCTGG + Intergenic
1164181029 19:22818916-22818938 TCCCTCTGTAGGCAGAGCCCAGG - Intergenic
1164227532 19:23258903-23258925 GCCCTCTGTAGAAAGAGCCCAGG + Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164431457 19:28192656-28192678 TCCCTCTGTGGATAGATGCTGGG + Intergenic
1164503787 19:28841450-28841472 TCCCTCTGTCCAGAGGGGGCGGG + Intergenic
1167825396 19:51968237-51968259 TTCCTCTTTGGAAAGAGGCCTGG + Intronic
1168484334 19:56748131-56748153 TCCCTCTTCTGGGAGGGGCCAGG + Intergenic
925119650 2:1408168-1408190 TCCCCGTGTGCAGAGAGGCCTGG + Intronic
926163548 2:10504461-10504483 TCCCTCAGCTGAAAGAGGTCAGG + Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
928379489 2:30805318-30805340 TCTCTTTGTGAAGAGAGGCCAGG + Intronic
929117383 2:38455972-38455994 TCCCTCTTAAGAGAGAGTCCTGG + Intergenic
929124765 2:38513078-38513100 TCCCTGTGTAGAGAGAGGGAGGG + Intergenic
930084332 2:47483356-47483378 TCCATCTGTTGACAGGAGCCAGG + Intronic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
935789487 2:106577826-106577848 TCCCTCTGTAGAAAGAGGAGAGG - Intergenic
937391972 2:121496790-121496812 TCCCTCTGTTAAGTGTGGGCAGG - Intronic
937935525 2:127240953-127240975 TCACTTTGTTGAGTGAGCCCAGG - Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938544702 2:132317279-132317301 TCCCTCTGTGAAGAGTGGGCAGG + Intergenic
940226937 2:151410154-151410176 TCCCTCTGTTGAAAGCTGCCCGG + Exonic
942053562 2:172162739-172162761 GCCCACAGTGGAGAGAGGCCAGG + Intergenic
942222521 2:173784359-173784381 TCGGCCTGTGGAGAGAGGCCTGG + Intergenic
942389552 2:175477891-175477913 GCCCTTTGTTGGGAGAGGACTGG + Intergenic
942903839 2:181157068-181157090 TCCCAATGTTGAAGGAGGCCTGG - Intergenic
944207751 2:197174607-197174629 TCCCCCTGGGGAGAGAGGCGGGG + Intronic
945115970 2:206408529-206408551 TTCCATTGTTGAGAGAGGGCAGG - Intergenic
948307252 2:236957448-236957470 TCCCTCTGTCTAGAGGAGCCAGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948903984 2:240969162-240969184 TCCCTCCAATGAGGGAGGCCTGG + Intronic
1169045739 20:2533268-2533290 TCCCATTTTTGACAGAGGCCGGG + Intergenic
1171873565 20:30550014-30550036 TCCCTCTGTGAAGAGTGGGCAGG + Intergenic
1173334351 20:42100890-42100912 GCACTCTGTGGACAGAGGCCAGG + Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1173757508 20:45530946-45530968 TCCCTCTCTTTAGAAAGGGCTGG - Intergenic
1173875103 20:46365305-46365327 GCCTTCTGTTCAGAGGGGCCAGG - Intergenic
1174106617 20:48166734-48166756 TCCCTCTGTGGAGTGAGATCAGG + Intergenic
1174552312 20:51370807-51370829 GCCATCTGGTGAGAGAGGACAGG + Intergenic
1174575081 20:51531551-51531573 ACCCTCTGTTGACTGAGACCTGG - Intronic
1176277138 20:64278863-64278885 TCCCTCTTCTCAGAGAGGCCAGG - Intronic
1176669046 21:9715037-9715059 TCTCTCTGGTGAGAGAGACAAGG + Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1179425546 21:41275401-41275423 ATCCTCTGTTGAGAAAGGCCCGG - Exonic
1180148440 21:45935039-45935061 TCCTTCTTTTGAGAGAGGTTGGG + Intronic
1180621434 22:17165168-17165190 TCCCCAGGTAGAGAGAGGCCAGG - Intronic
1181261982 22:21604885-21604907 TCCCTGGGTGGTGAGAGGCCTGG + Intronic
1181368278 22:22396945-22396967 CCCCTCAATTAAGAGAGGCCAGG + Intergenic
1181393925 22:22604618-22604640 TTCCTATGTTAAGAGAGGCCTGG + Intergenic
1181411125 22:22720588-22720610 TTCCTATGATAAGAGAGGCCTGG + Intergenic
1181854496 22:25772366-25772388 TGACACTGATGAGAGAGGCCAGG - Exonic
1182394929 22:30028386-30028408 TCTCTGTGTGGAGAGAGGGCGGG - Intronic
1182547512 22:31084688-31084710 TCCCTCTCTTAAGCGAGGCTCGG + Intronic
1183064002 22:35351323-35351345 TCCCTCTCTTTACAGAGCCCCGG + Intergenic
1183306711 22:37086636-37086658 CTCCTCGGGTGAGAGAGGCCAGG + Intronic
1183484768 22:38082877-38082899 TGCCTCTGTTGGGAGGGGGCGGG + Exonic
1183539801 22:38423428-38423450 TTGCTCTTTTGGGAGAGGCCTGG - Intergenic
1184478019 22:44731873-44731895 CCCCTCTGTAGAGTGAGGCCAGG - Intronic
1184658972 22:45956650-45956672 TCCTCCTGTTGACAGACGCCTGG - Intronic
1185057426 22:48588205-48588227 TGCGTCTGGTGAGAGGGGCCTGG + Intronic
950168843 3:10822328-10822350 TCCCTCTGTTTAGAGACACCTGG - Intronic
950206148 3:11082692-11082714 TCCCTTTGTTGAGAGATCTCAGG - Intergenic
950469400 3:13175087-13175109 TCCATCTGGTGAGAGAGGGAAGG - Intergenic
950544437 3:13630183-13630205 TCCCTCAGTCCAGAGAGGCTGGG + Intronic
954135961 3:48582354-48582376 TCCCCCTGTGGAGAGAGGATAGG + Exonic
955133431 3:56192604-56192626 TCTCTGTGTTTAGGGAGGCCTGG - Intronic
955777961 3:62453792-62453814 GCCCTCTGGTGACAGAGCCCTGG - Intronic
956347239 3:68293866-68293888 TCCCTCTTGTGAAAGAGGTCAGG + Intronic
956427881 3:69155456-69155478 TCCCTCTGTGGAGACAGGAGTGG + Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
960376323 3:116906241-116906263 TCCCTCTGAAGAGAGAGGTTTGG + Intronic
960746123 3:120890898-120890920 TCCTTCTGTGGAGAGAGGGAGGG + Intergenic
961305156 3:125953783-125953805 TCCCTCTGCTGAAGGAGGGCGGG + Intergenic
962198237 3:133380955-133380977 TACCACTGTGGAGAGAGGACTGG - Exonic
962426509 3:135273293-135273315 TCCCTGTGTTGGAAGAAGCCTGG - Intergenic
963265495 3:143236054-143236076 TTCCTCTCTTGTGAGAGACCTGG + Intergenic
964526586 3:157621389-157621411 CTCCTCTGTTGAGAGAGCCATGG + Intronic
964669332 3:159208319-159208341 TCCCTCTGTCGAGAGAGACCAGG + Intronic
969370276 4:6727490-6727512 TCACTCCCTTGAGAGAGGGCAGG + Intergenic
969414458 4:7049643-7049665 TCCCTCTGATGCCAGAGGCTGGG - Intronic
970272926 4:14366621-14366643 TCCATCTGATGACAGAGCCCAGG - Intergenic
972559407 4:40213609-40213631 TCGCTCTGGTGAGAGAGGAGTGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
974504703 4:62754177-62754199 TCCAGCTGTTGAGAGAAGTCAGG - Intergenic
975504821 4:75126095-75126117 TGCTTCTGTAGAGACAGGCCTGG - Intergenic
976887417 4:90002723-90002745 CTCCTTTGTTGAGAGAGGCTGGG + Intergenic
980085620 4:128387305-128387327 TGTCTCTGGTCAGAGAGGCCTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
980369926 4:131855404-131855426 CCCCTCTTTTGACAGAAGCCAGG - Intergenic
983338563 4:166427566-166427588 TCCTTCAGTTGAGAGAGGCTTGG - Intergenic
991969571 5:72126113-72126135 TCCCTGTGTTGAGGGAAGCAGGG + Intronic
993496381 5:88614387-88614409 TCACTGTGTTGAGAGAGGTTAGG - Intergenic
995588257 5:113671643-113671665 TCCTTCTGCCGAGAGAGGCCAGG + Intergenic
995760887 5:115560641-115560663 TCCCTCTGCTGCCACAGGCCAGG - Intergenic
996711390 5:126546905-126546927 TCCCTCTCATGAGAAAGACCAGG - Intronic
996832462 5:127755051-127755073 TCCCCCTGGTCAGAGAGGCTTGG + Intergenic
997615744 5:135245008-135245030 TTCTTCTGTTTAGAGGGGCCGGG + Intronic
998705788 5:144758605-144758627 TCCCTCTCCAGAGAGAAGCCTGG + Intergenic
1000906783 5:166973915-166973937 TCCCATTTTTAAGAGAGGCCAGG - Intergenic
1001411495 5:171515582-171515604 TCCCTCTGCTGAGAGAGGCGAGG + Intergenic
1001971345 5:175957361-175957383 TGGCTCAGTTGAGAGTGGCCAGG - Intronic
1002246097 5:177886416-177886438 TGGCTCAGTTGAGAGTGGCCAGG + Intergenic
1003047744 6:2749800-2749822 TCCCTCTGCAGAGGGAGGCCAGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003394832 6:5744145-5744167 TCACTCTGGAGAGAGAAGCCTGG + Intronic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005863711 6:29922373-29922395 TCCCTCTCTTGAGTGTGGCTTGG + Intergenic
1005866112 6:29938652-29938674 TCCCTCTCTTGAGTGTGGCTTGG + Intergenic
1006519929 6:34565340-34565362 GCCCGCTGTTGACAGAGTCCTGG - Intergenic
1006744166 6:36330004-36330026 TCCCTCTGTGGAGAGGCTCCTGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007117879 6:39356679-39356701 TCCATCTGATGCCAGAGGCCAGG - Intronic
1010902393 6:81442962-81442984 TCCCTCTGTTGAGCGGGGTGGGG + Intergenic
1012817873 6:104047229-104047251 TCCCACTGTTGAGATATGCCAGG - Intergenic
1014921560 6:127219888-127219910 TCCATCCATTGAGAGAGGTCTGG + Intergenic
1017954255 6:159165369-159165391 TCCCTCTGTTCATAGAATCCTGG + Intergenic
1021138208 7:16991907-16991929 TCCCTCTGCAGAGCAAGGCCAGG - Intergenic
1021536768 7:21713968-21713990 TCCCTCTGTACAGAGAACCCAGG + Intronic
1022892915 7:34719302-34719324 TCCCTCTGTTGAGAAGTGCACGG - Intronic
1023001209 7:35809825-35809847 TCTCTCTGTTGAGAGTTGACAGG + Intronic
1025223913 7:57140099-57140121 TCCAACTGTGGAGAGAGACCAGG - Intergenic
1026589598 7:71683430-71683452 TCCTTCTGCTGAGAGCCGCCTGG - Intronic
1027602559 7:80257195-80257217 TCCCTGTGCTGAGAGAGTCAAGG + Intergenic
1029045819 7:97627111-97627133 TCCGTCTGTGGAGAGAGCCGAGG + Intergenic
1032433025 7:131878395-131878417 GGCATCTGGTGAGAGAGGCCAGG + Intergenic
1035027317 7:155834512-155834534 TGGATCTGTTGGGAGAGGCCGGG - Intergenic
1035647174 8:1233521-1233543 GCCCTGTGATGTGAGAGGCCTGG + Intergenic
1036652673 8:10655159-10655181 TCCCTCTGGGGAGAGTGGCCAGG - Intronic
1037233471 8:16688308-16688330 TCTCACTCTTGAGAGAGGACTGG + Intergenic
1038755803 8:30339828-30339850 TGCCTCTGCTGAGAGTGACCTGG + Intergenic
1040379429 8:46858048-46858070 TCCCTCTCTTGGCAGAGTCCAGG - Intergenic
1040382417 8:46885708-46885730 TCCCACTCTTGGCAGAGGCCAGG + Intergenic
1042059582 8:64802255-64802277 TCCTTCTTTTGAGAGAGACAGGG - Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043719042 8:83521929-83521951 ACCCTCTGTCGAGAGATACCAGG + Intergenic
1044071001 8:87759692-87759714 TCTCATTGTTGAGAGAGCCCAGG - Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1049509657 8:143021089-143021111 GCCCTCTGCTGGGAGCGGCCTGG - Intronic
1049599210 8:143499246-143499268 TCCCTCTGTCCAGAGAACCCAGG - Intronic
1051101230 9:13524344-13524366 CCCCTCTGTTTACAGAAGCCTGG + Intergenic
1051142529 9:13993221-13993243 TCCCTGTATTAACAGAGGCCAGG + Intergenic
1051212968 9:14764636-14764658 GCCTTCAGCTGAGAGAGGCCTGG + Intronic
1052279467 9:26716472-26716494 TACCGCTGTTGACAGAGCCCTGG + Intergenic
1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG + Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055323362 9:75103640-75103662 TCCCTCTGTTGCTAGAGTGCTGG + Intronic
1057126223 9:92618192-92618214 TCCTTTTGTTGAGAAAGGCCTGG + Exonic
1058841094 9:108909803-108909825 TCCCTGTGATGAGATAGGACAGG - Intronic
1062496532 9:136834096-136834118 TCCCGCTGCTGAGACAGGCGAGG - Intronic
1062737221 9:138144121-138144143 CCCCTCTTCTCAGAGAGGCCGGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1189515581 X:41710928-41710950 TGCCTCTGTCCAGAGAGGACAGG + Intronic
1190473067 X:50801705-50801727 TCCCTCTGTTGCGTGAGCCCTGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193809109 X:86030676-86030698 TCCCTCTGTAGAGGGAGTCATGG + Intronic
1196925472 X:120629846-120629868 TCCCTCTCTTGGGGGAGGCCTGG - Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1197649982 X:129053887-129053909 TCCCTCTGTTGAGAGCAACAAGG + Intergenic
1198229240 X:134673736-134673758 TCCATCTGTTGAGGGAGGAAAGG + Intronic
1199421257 X:147647310-147647332 TTCCCCTGTTGAGAGAGGTGAGG - Intergenic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1199783248 X:151082319-151082341 TCCCTCAGTAAGGAGAGGCCAGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200844352 Y:7816138-7816160 GCCTTCTGTTGACAGAGTCCAGG + Intergenic
1202246739 Y:22827903-22827925 TCCCTCTCTTGGCAGAGTCCAGG - Intergenic
1202263642 Y:22995569-22995591 TCCCTCTCTTGACAGAGTCCAGG - Intronic
1202399728 Y:24461651-24461673 TCCCTCTCTTGGCAGAGTCCAGG - Intergenic
1202416632 Y:24629310-24629332 TCCCTCTCTTGACAGAGTCCAGG - Intronic
1202454155 Y:25040776-25040798 TCCCTCTCTTGACAGAGTCCAGG + Intronic
1202471052 Y:25208435-25208457 TCCCTCTCTTGGCAGAGTCCAGG + Intergenic