ID: 1137576706

View in Genome Browser
Species Human (GRCh38)
Location 16:49604801-49604823
Sequence GTGGCAGCCCAGGAATGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 387}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137576706_1137576711 -5 Left 1137576706 16:49604801-49604823 CCACCCCATTCCTGGGCTGCCAC 0: 1
1: 0
2: 4
3: 44
4: 387
Right 1137576711 16:49604819-49604841 GCCACGACCACTGTCCCTACTGG 0: 1
1: 0
2: 0
3: 6
4: 83
1137576706_1137576716 10 Left 1137576706 16:49604801-49604823 CCACCCCATTCCTGGGCTGCCAC 0: 1
1: 0
2: 4
3: 44
4: 387
Right 1137576716 16:49604834-49604856 CCTACTGGTGTGATGAAAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137576706 Original CRISPR GTGGCAGCCCAGGAATGGGG TGG (reversed) Intronic
900224989 1:1528826-1528848 GGGGGAGCCCAGGGAAGGGGAGG - Intronic
900701489 1:4051237-4051259 CAGGCAGCCCTGTAATGGGGTGG + Intergenic
900780104 1:4612374-4612396 CTGGCAGCCCAGGAATGCCCAGG - Intergenic
900933737 1:5752611-5752633 GTAGGAGGCCATGAATGGGGTGG + Intergenic
900994026 1:6110585-6110607 GAGGCAGCTCAGGGAGGGGGAGG + Intronic
900995848 1:6123284-6123306 GTGGCTGCCCAGGCCTGGGGTGG + Intronic
901475961 1:9489493-9489515 GTGGTTGCCCAGGGCTGGGGAGG - Intergenic
902673069 1:17988526-17988548 GTGGCTGCCTGGGAATGGGACGG - Intergenic
903153715 1:21430295-21430317 CTGGCAGCCCAGGAGTGGGGAGG + Intergenic
903170290 1:21548218-21548240 GTGGCAGCCCTGGAAGCGGAGGG - Intronic
903186692 1:21633287-21633309 GGGGCAGGACAGGAAAGGGGAGG - Intronic
903188485 1:21642806-21642828 GTGGCAGGTCAGCAATGTGGAGG - Intronic
903780175 1:25815809-25815831 AAGGCAGCCTAGGAGTGGGGTGG - Exonic
903791744 1:25897980-25898002 GGGGCAGCACAGGGATGAGGTGG - Intronic
903832335 1:26182758-26182780 GTGGCCCCTCAGGACTGGGGAGG - Intronic
904409297 1:30315332-30315354 GTGACAGCACAGGCGTGGGGAGG + Intergenic
904467048 1:30714370-30714392 GTGGCTGCCCAGGAGGAGGGAGG + Intronic
906712424 1:47940833-47940855 ATGGCAGTCCAGGAATCCGGAGG + Intronic
907275863 1:53316301-53316323 GAGGCAGGCTGGGAATGGGGAGG + Intronic
907437163 1:54457342-54457364 GTGGCCACCCAGGAAGGGGCAGG - Intergenic
907583710 1:55595358-55595380 GTGGCAGCCTAGGATGGGTGGGG - Intergenic
910640290 1:89453634-89453656 GTGGCAACTGAGGAATGGGCAGG + Intergenic
910795397 1:91092483-91092505 GTGGTAGTGCAGTAATGGGGGGG + Intergenic
912261816 1:108118433-108118455 CTGGCAGCACAGGAATTGGCTGG - Intergenic
914513234 1:148352706-148352728 GGGTCACCCCAGGTATGGGGTGG + Intergenic
915268049 1:154732682-154732704 GTGGCTGCACAGCAGTGGGGTGG + Intronic
915922095 1:159983693-159983715 GTGGCAAGGCAGGGATGGGGTGG + Intergenic
915952644 1:160199757-160199779 GGGTCAGCCCAGGGATGGAGAGG - Intronic
917294512 1:173504923-173504945 CTGGCAGTGCAAGAATGGGGAGG - Intronic
917532410 1:175848309-175848331 GTGGCAGCCTAGGAGTGGTATGG + Intergenic
917956251 1:180101899-180101921 GTGGCAGCCCAGGGAAGGCATGG - Intronic
918085252 1:181239559-181239581 GTGGCAACCCAGGAAGGGAGTGG + Intergenic
918315170 1:183317157-183317179 GTGGCAGCCTCAGAGTGGGGTGG + Intronic
919544616 1:198899447-198899469 GTGGGGACACAGGAATGGGGCGG + Intergenic
920294350 1:204946780-204946802 CTGGCAGCCCAGGGATGGTGGGG - Intronic
920544131 1:206801461-206801483 GAGGCTGACCAGGAATGGGGAGG - Intronic
920920309 1:210292710-210292732 GTGGCAGCGCAGGCGTGGGAGGG - Intergenic
921346673 1:214193376-214193398 TTTGCAGCCTAGGAAGGGGGTGG - Intergenic
921384126 1:214552089-214552111 GGAGCAGCCCAGGGTTGGGGTGG - Intronic
922461530 1:225817401-225817423 CAGGCAGGCCAGGAATGGGAGGG + Intronic
922472288 1:225883768-225883790 GTGGCTGTCCAGGAGTGGGGTGG + Intergenic
922475736 1:225905899-225905921 GTGGCTGTCCAGGGGTGGGGTGG - Intronic
922494012 1:226041891-226041913 TCGGCAGCCCAGGGACGGGGTGG + Intergenic
922812704 1:228426694-228426716 GTTGGAGCCCAGGGAGGGGGGGG + Intergenic
922913223 1:229234633-229234655 CCAGCAGCCCTGGAATGGGGTGG - Intergenic
923375471 1:233357739-233357761 GGGGCTGCCCATGCATGGGGAGG + Intronic
923979346 1:239303091-239303113 GAGGCTGCCCAGGACTGGTGTGG - Intergenic
1062916028 10:1241802-1241824 GGGGCAGTGCAGGAATGTGGGGG + Intronic
1063358140 10:5421785-5421807 GTGGCTGCCTAGGGCTGGGGTGG - Intronic
1064902130 10:20306932-20306954 GTGGCAGCCCTAGAGTGGGCTGG + Intergenic
1065077687 10:22097700-22097722 GTGACAGACCAAGGATGGGGAGG - Intergenic
1065101014 10:22333976-22333998 GTGGGATGCCAGGAATGGGATGG + Intergenic
1066196142 10:33102151-33102173 AGGGGAGCCCAGGAATGAGGGGG - Intergenic
1067053034 10:43035971-43035993 GTGGTTGCCTAGGGATGGGGCGG + Intergenic
1067083509 10:43226509-43226531 GTGGGAGCCCATGGATGGCGTGG - Intronic
1067711455 10:48654490-48654512 GTCTCATCCCAGGAATAGGGTGG + Intronic
1068561013 10:58513701-58513723 GAGGCTGCCAGGGAATGGGGAGG - Intronic
1068886447 10:62102810-62102832 GTGGAAGCTCAGGACAGGGGAGG + Intergenic
1069820420 10:71224126-71224148 CTGGCAGCCCAGGAAAGCCGGGG + Intronic
1070324838 10:75381687-75381709 GAGGCAGCCCAGGATTGGCATGG - Intergenic
1070642806 10:78181394-78181416 GTGGCAACCTAGCAGTGGGGAGG + Intergenic
1071504046 10:86222293-86222315 CTGGAAGCCCAGGCTTGGGGTGG - Intronic
1072272389 10:93789412-93789434 GGGGCAGCCCAGGCAAGAGGAGG + Intronic
1072810570 10:98458171-98458193 GTGAAAGGACAGGAATGGGGCGG - Intronic
1073071763 10:100798802-100798824 TTGGGAGCTGAGGAATGGGGTGG - Intronic
1073433699 10:103503173-103503195 GGGCCAGCCCAGGAAGTGGGAGG + Intronic
1073480244 10:103781999-103782021 GAGGCTGCCCAGGAATGGCGTGG - Intronic
1074771840 10:116739972-116739994 GTGGCAGTCCTGGGTTGGGGAGG - Intronic
1076017163 10:127037148-127037170 GTGGAAGCCCAGACATGGTGAGG + Intronic
1076048382 10:127313007-127313029 TTTGCAGCCCAGGACTGGGAGGG - Intronic
1076136883 10:128051253-128051275 GAGGGAGTCCAGGAATAGGGTGG + Intronic
1076387090 10:130065089-130065111 GCTGCAGCCCAGGAAGGGTGGGG + Intergenic
1076454291 10:130578721-130578743 GCAGCAGCCCAGGGAAGGGGAGG - Intergenic
1076535415 10:131173932-131173954 CTGGCAGCTCAGGACTGGGAAGG + Intronic
1076750922 10:132542567-132542589 GTGGCAGCCCTCGAGTGGGGTGG + Intronic
1077231146 11:1458695-1458717 CTGCCAGTCCAGGACTGGGGTGG - Intronic
1077505525 11:2928359-2928381 GTGGAGGCCCAGGAATGGGCGGG - Exonic
1078101025 11:8330394-8330416 GTGGCAACCCAGAAGTGAGGAGG + Intergenic
1080123304 11:28702180-28702202 GTGACAGCCCAGGAAAGCAGTGG - Intergenic
1083596097 11:63918881-63918903 GGGGCAGCCCTGGAGTAGGGAGG - Intergenic
1084416585 11:69036003-69036025 GTGGCAGCCAAGGAAGGGGCCGG - Intergenic
1084900723 11:72307981-72308003 GTGGTAGTGAAGGAATGGGGGGG + Intronic
1085199053 11:74690645-74690667 GGGGCAGCCAAGGACTAGGGAGG + Intergenic
1086424691 11:86672097-86672119 GTGGCAGCCGAGGAGTGGCGGGG - Intronic
1086547637 11:88016586-88016608 GTGGCATCTCAGGAAGGTGGAGG - Intergenic
1087152742 11:94873045-94873067 GAGGCAGCCCAAGTTTGGGGTGG - Exonic
1088521684 11:110708709-110708731 GTGGTTGCCTGGGAATGGGGAGG + Intronic
1088813394 11:113406291-113406313 GTGCCATTCCAGGAATGGGAGGG - Intergenic
1089660357 11:119981563-119981585 GGGGCCTCCCAGGAATGTGGAGG - Intergenic
1089836187 11:121372730-121372752 GTGGCAGACAAGGAAGTGGGGGG + Intergenic
1090689626 11:129165297-129165319 TTGGCAGCCCATCAATGGTGAGG + Intronic
1091305080 11:134531531-134531553 CTGGCAGCCCGGGGATGTGGGGG - Intergenic
1091831245 12:3552600-3552622 CTGGCAGCCCAGGAAAGGGCTGG + Intronic
1091841272 12:3622985-3623007 CTAGCAGCCCAGGAAGGGAGAGG + Intronic
1092884583 12:12913911-12913933 TTGGCAGCCCAGGAAAGGCAGGG + Exonic
1093971746 12:25382287-25382309 ATGGCAGACTGGGAATGGGGAGG + Intergenic
1094047589 12:26184115-26184137 GTGGCAGTCAAGGTGTGGGGTGG + Intronic
1094533928 12:31304424-31304446 GTGGGAGGCCAGGAATGTGCAGG + Intronic
1094743034 12:33311074-33311096 GTGGAAGCCCAGTAATGAGGAGG + Intergenic
1095967933 12:47882121-47882143 GGGGCAGTCCTGCAATGGGGTGG + Intronic
1096500623 12:52062124-52062146 GTGGCACCTCAGGGCTGGGGAGG - Intergenic
1096979307 12:55719246-55719268 ATGGGGGCCCAGGATTGGGGTGG - Intronic
1098479949 12:70945867-70945889 GTGGCATCCCATTAATGGGCTGG - Intergenic
1099428521 12:82553226-82553248 GAGCTAGCCCAGTAATGGGGTGG + Intergenic
1099668680 12:85662398-85662420 GTGGGAGCTTAGGCATGGGGTGG - Intergenic
1100243099 12:92729484-92729506 GCTGAAGCCCAGGAGTGGGGTGG - Intronic
1100689814 12:97027845-97027867 TAGGAAGCCCAGGAAAGGGGAGG + Intergenic
1102796251 12:115691401-115691423 CTGGCACCCCTGGAGTGGGGTGG + Intergenic
1102803036 12:115753377-115753399 TTGGCAGCCTTGAAATGGGGTGG - Intergenic
1102873381 12:116431409-116431431 GAGGCAGCCAAGGGTTGGGGAGG - Intergenic
1103360871 12:120353006-120353028 GTGGCAACCCTGGAGTCGGGTGG + Intronic
1103443073 12:120978115-120978137 GTGTCAGGCCGGGAGTGGGGTGG + Intergenic
1103946276 12:124528446-124528468 ATGGAAGCCCAGGAATGGGCTGG - Intronic
1104421581 12:128640454-128640476 GTGGCCGCCCAGGGCTGGGAGGG + Intronic
1105417146 13:20223347-20223369 GTGGCTGCCCAGGAAGTGTGGGG - Exonic
1106101499 13:26697682-26697704 GTGGCATCCCAGGGTTTGGGGGG - Intergenic
1106130062 13:26932585-26932607 GTGGGTGCACAGGACTGGGGTGG + Intergenic
1107380945 13:39855982-39856004 GGGGCAGCACAGCAGTGGGGTGG + Intergenic
1107393585 13:39992871-39992893 CTGGCAGCCCAGGAATAAGGTGG + Intergenic
1111128827 13:83948001-83948023 GTGGCATTCCTGGACTGGGGTGG - Intergenic
1113856797 13:113450956-113450978 TTAGCAGACCAGGAAGGGGGGGG - Intronic
1115668552 14:35582463-35582485 GTGGGACACCAGGAATGGGGAGG - Intronic
1116236531 14:42285628-42285650 GGTGCAGCCCATGGATGGGGAGG - Intergenic
1117073994 14:52082546-52082568 GTGGCAGCCAGGGATTAGGGTGG - Intergenic
1117548778 14:56813260-56813282 GAGGCAGACAAGGAAGGGGGGGG + Intergenic
1117868024 14:60169638-60169660 GTGGCTGCCTAGGGAAGGGGTGG - Intronic
1118778466 14:68989520-68989542 GTGGCCAACCAGAAATGGGGAGG - Intergenic
1119680051 14:76585376-76585398 GTGGCAGGCTAGGAATGATGGGG - Intergenic
1119751664 14:77082894-77082916 ATAGCAGACCAGGAATGGGGAGG + Intergenic
1121026474 14:90620139-90620161 CTGCAAGCCCAGGCATGGGGAGG - Intronic
1121662900 14:95649151-95649173 GTGTCAACCTAGGAATTGGGGGG + Intergenic
1121690843 14:95876398-95876420 GTGGCAGGCCGGGATTGGGGAGG - Intergenic
1122092112 14:99347702-99347724 GTGGCTGCCTGGGGATGGGGAGG - Intergenic
1122115950 14:99527370-99527392 GTGTCAGCTCGGGCATGGGGTGG + Intronic
1122305713 14:100765123-100765145 GTGGCAGATCAGGGAGGGGGAGG - Intergenic
1122651500 14:103229376-103229398 GTGGCCGCCCAGGTAGGGTGTGG - Intergenic
1122737053 14:103848750-103848772 GTGGCTCCCCAGGAATGGGCTGG - Intergenic
1122828425 14:104383530-104383552 CTGGTGGCCCAGGAGTGGGGGGG + Intergenic
1122897515 14:104767665-104767687 GCAGCATCCCAGGAGTGGGGTGG - Intronic
1123217132 14:106821262-106821284 CTGCCAGCCCAGGAAAGGGCTGG - Intergenic
1123527926 15:21120477-21120499 GTGACACCCCAGGCAGGGGGGGG + Intergenic
1124200076 15:27671904-27671926 GTGGGAGCCCAGGAAGGATGGGG - Intergenic
1124762170 15:32455228-32455250 ATGACAGCCCAGTAATGGAGCGG + Intronic
1125049424 15:35279532-35279554 GTGGGAGCCCACTTATGGGGAGG - Intronic
1125815085 15:42576982-42577004 GTGGTAGCTCAGGGCTGGGGGGG + Intronic
1126675237 15:51155158-51155180 GTGGGACCGCAGGAATGAGGAGG - Intergenic
1126999070 15:54481325-54481347 GTGGCAGTGCAGGACTGGGCAGG + Intronic
1129457378 15:75683094-75683116 GTGGCAGCCCAGGGCCGGGGAGG - Intronic
1129687922 15:77696870-77696892 GTGGCACCACAGGCATGGGCGGG + Intronic
1129705559 15:77792206-77792228 GGGCCAGCCTGGGAATGGGGCGG - Intronic
1130274448 15:82469199-82469221 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1130466795 15:84196573-84196595 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1130497469 15:84476963-84476985 GTGGCAGCCCAGGGCCGGGGAGG - Intergenic
1130589090 15:85201166-85201188 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1131058187 15:89388847-89388869 CTGGCTGCCCAGCACTGGGGTGG - Intergenic
1131401094 15:92126196-92126218 GTCGCAGCCCAGGAAGAGGAAGG - Exonic
1131524762 15:93143934-93143956 GTGACAGGCCAGGCATGGCGGGG - Intergenic
1132255771 15:100374185-100374207 GCAGCAGCCCAGGATTGGGTGGG - Intergenic
1132551453 16:555472-555494 GGGCCACCCCAGGACTGGGGTGG - Intergenic
1132559450 16:586777-586799 GCAGCAGGCCAGGACTGGGGGGG + Intergenic
1132572680 16:650876-650898 GAGGCAGCCCTGGGGTGGGGCGG + Intronic
1132627677 16:899489-899511 GTGGCTGCCCAGGACCAGGGCGG + Intronic
1132802418 16:1760962-1760984 CTGGCTGCCCGGGAATGCGGAGG - Intronic
1133010348 16:2907125-2907147 TTAGCAGACCAGGAAAGGGGGGG - Intergenic
1133017282 16:2949915-2949937 GTAACAGCCCAGGCATGGGGAGG - Exonic
1133225970 16:4340540-4340562 GTGGCACCCCAGGGTCGGGGTGG + Intronic
1133295065 16:4747638-4747660 GTGGGATCCCAGGAGTGGGCAGG + Intronic
1133782741 16:8952520-8952542 GGGGGAGCCCAGGAATGGGGTGG - Intronic
1134095287 16:11414810-11414832 CTGGCAGCCAAGGACTGGGAGGG - Intronic
1135631030 16:24035647-24035669 GGGGCAGTCCAGGGACGGGGAGG + Intronic
1136394835 16:29987201-29987223 CTGGCAGCCCAGGGTGGGGGTGG + Exonic
1137576706 16:49604801-49604823 GTGGCAGCCCAGGAATGGGGTGG - Intronic
1138101327 16:54254438-54254460 AAGGCAGCGCAGGGATGGGGTGG + Intronic
1138458239 16:57133338-57133360 CTGGCAGCCCAGGGGAGGGGAGG - Intronic
1139058166 16:63213184-63213206 GTGGGTGCCTAGGACTGGGGAGG + Intergenic
1139671651 16:68496465-68496487 GTGGCTGCCTAGGGCTGGGGAGG + Intergenic
1139953555 16:70683066-70683088 GTGGCTGCTCTGGAGTGGGGAGG + Intronic
1141717131 16:85733375-85733397 GTGGCTGCCAAGGGCTGGGGAGG + Intronic
1141999211 16:87654592-87654614 GTGGCAGCTGGGGAATGGGATGG + Intronic
1142369148 16:89668558-89668580 GTGGCACTCCAGGAAGGGGGCGG + Intronic
1142369160 16:89668605-89668627 GTGGCACTCCAGGAAGGGGGCGG + Intronic
1142369169 16:89668652-89668674 GTGGCACTCCACGAAGGGGGTGG + Intronic
1143433962 17:6908947-6908969 GTGGCTGCTCAGGGAAGGGGTGG + Intronic
1144236172 17:13262551-13262573 GTGGAAGGTCAGGGATGGGGAGG + Intergenic
1144632642 17:16881896-16881918 GCTGCAGCCCTGGCATGGGGTGG - Intergenic
1146000132 17:29125989-29126011 GTCCCAGCCCAGAAATGGAGAGG + Intronic
1146696418 17:34911906-34911928 GAGGCATCCCAGAAATGGGATGG + Intergenic
1147424933 17:40341966-40341988 GGGGCAGCCTGGGAAGGGGGAGG - Intronic
1147813545 17:43191580-43191602 ATGTAAGCCCAGGACTGGGGTGG + Exonic
1147914277 17:43877381-43877403 GGAGGAGTCCAGGAATGGGGTGG + Intronic
1147923728 17:43934066-43934088 GTGGTAGCCCTGCAATGGGCAGG - Intergenic
1148094974 17:45046180-45046202 TTGTCAGTCCAGGAATGTGGAGG - Intronic
1148190469 17:45675207-45675229 GTGGCCGCCCACGGCTGGGGAGG - Intergenic
1148349552 17:46930129-46930151 GAGGGAGCCCAGCAGTGGGGTGG - Intronic
1148496085 17:48054337-48054359 GAGGCGGCCCAGGGATGGGCTGG + Intronic
1148515269 17:48211018-48211040 GAGGCACCCCAGGAATGGGAGGG + Intronic
1148749462 17:49936079-49936101 GGGGTAGCCCAGGACTGGGTTGG + Intergenic
1148779423 17:50113087-50113109 GTGGGAGGCCAGGACTGGGAAGG - Intronic
1149684844 17:58529379-58529401 GTGGGAGCCAAGGGAAGGGGAGG - Intronic
1149771091 17:59321593-59321615 GAGGCTTCCCAGGTATGGGGAGG + Intergenic
1149795993 17:59520488-59520510 GTGGCTGTCAAGGGATGGGGAGG - Intergenic
1150454721 17:65298080-65298102 ATGGCAGTCCTGGAATGGGAAGG - Intergenic
1150603515 17:66671298-66671320 GAGGCAGCCAAGAAGTGGGGGGG + Intronic
1151427435 17:74040260-74040282 ATGGCAGCCCAGAAATGCAGGGG - Intergenic
1152008136 17:77695168-77695190 CTGGCAGCCCAGGACCCGGGAGG - Intergenic
1152077382 17:78168166-78168188 GTGGCAGGCCAGGCAGGGAGGGG + Intergenic
1152256438 17:79242750-79242772 GTGGAGGCCCAGTAAGGGGGTGG - Intronic
1153873360 18:9341621-9341643 GTGGCAGGGCAGGAGTGGGAAGG - Intronic
1158004285 18:52654346-52654368 ATTGCAGCACAGAAATGGGGAGG + Intronic
1159844294 18:73440171-73440193 GAGGCAGCCCAGGTTTGGGATGG + Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160428276 18:78793181-78793203 GTTTCAACACAGGAATGGGGAGG + Intergenic
1160868219 19:1265543-1265565 GTCACAGCTCAGGAATGTGGAGG - Intronic
1160900909 19:1427963-1427985 GAGGCAGCCCCGGAATTGGGGGG + Intronic
1161105779 19:2443319-2443341 GCGCCAGCCCAGGAAGGAGGAGG + Intronic
1161342512 19:3751003-3751025 GTGGCAGGCAAGGGATGAGGTGG + Exonic
1161707093 19:5827303-5827325 GGGGCAGCCCAGCATAGGGGCGG + Intronic
1161793282 19:6373302-6373324 GAGACAGCGCAGGGATGGGGCGG + Intronic
1162364140 19:10237856-10237878 GTGGTGGCACAGGAATGGGGTGG - Intergenic
1162430638 19:10626053-10626075 CTGGCAGGCCAGGACAGGGGAGG - Intronic
1162460182 19:10810173-10810195 GTGGCAGGGCAGGCAGGGGGCGG - Intronic
1162806487 19:13140260-13140282 GTGGCAGGCCAGGAGGCGGGGGG - Exonic
1163392611 19:17039501-17039523 CAGGCAGCCCAGGAGTGGGAGGG + Intergenic
1163529958 19:17843241-17843263 GGGTCAGCCCAGGATTGGGGGGG - Intronic
1163658417 19:18561851-18561873 GTGCCACCCCAGGAATTTGGAGG - Intronic
1163739185 19:19000157-19000179 GTGGCAGCAGAGGAATCCGGGGG - Intronic
1163784893 19:19269953-19269975 GTGGCTGCCCAGGCACAGGGTGG + Intronic
1164435082 19:28222023-28222045 ATGGCAGGCGAGGAATGGGAAGG - Intergenic
1164454275 19:28394226-28394248 GTGGCAGCCCTCAAAGGGGGTGG - Intergenic
1164559022 19:29275901-29275923 GTGGCAGCGGAGGAAGGGAGGGG - Intergenic
1165077060 19:33285641-33285663 GTGTCAGCGCAGAAGTGGGGTGG + Intergenic
1165221203 19:34317995-34318017 GTGGAAGCCCAGGAGTTTGGGGG + Intronic
1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG + Intronic
1165393787 19:35552997-35553019 GAGGGAGCCCAGGGATGGGATGG + Intronic
1165815139 19:38637210-38637232 GTGGCAGCCCAGCCCTGTGGTGG + Intergenic
1165843817 19:38805469-38805491 GTGACAGCCCAGAAATGGTCAGG - Intronic
1166048474 19:40243517-40243539 CTGGCAGCCCAGGGATGTAGAGG + Intronic
1166713255 19:44950640-44950662 GTGTCAGCCCAGGCCTGGTGCGG - Intronic
1166782196 19:45348617-45348639 GGGGCGCCCCAGGAATGGAGGGG - Intronic
1167298051 19:48663378-48663400 GTGGAAGGCCAGAAAGGGGGTGG + Intronic
1167452208 19:49577924-49577946 GTGGCTGCCAAAGACTGGGGTGG + Intronic
1167520293 19:49950791-49950813 GTGGATGCCCAGGAAGGAGGAGG + Intronic
1168473644 19:56660804-56660826 GTGGCAGAGCAGCAATAGGGAGG - Intergenic
1168526175 19:57090437-57090459 GAGCCAGCCCGGGGATGGGGAGG + Intergenic
925056477 2:861022-861044 GTGGGGGCTGAGGAATGGGGGGG - Intergenic
925056490 2:861057-861079 GTGGGGGCTGAGGAATGGGGGGG - Intergenic
928179701 2:29060024-29060046 AGCGCAGCCCAGGAATGAGGGGG + Exonic
929127205 2:38532879-38532901 CTTGAAGCCAAGGAATGGGGTGG - Intergenic
929928715 2:46235793-46235815 GAGGCAGCTCAGGATTGGGAGGG - Intergenic
930032780 2:47068671-47068693 GTGCCAGCCCAGGGATAAGGTGG - Intronic
931771789 2:65503738-65503760 GTTGGGGCCCAGGATTGGGGTGG + Intergenic
931779531 2:65567259-65567281 GTGGTTGCCCAGGAATAGTGAGG + Intergenic
932918926 2:75887572-75887594 GTGGCAGCAGAGGAAAGAGGAGG - Intergenic
933366718 2:81362680-81362702 GTGGCAGCCTGGGATGGGGGAGG - Intergenic
934845118 2:97657388-97657410 CTGGCAGCCTTGGCATGGGGAGG - Intronic
934949158 2:98564538-98564560 GTGGCAGCAGAGGAAGGGGGCGG + Intronic
935151658 2:100442344-100442366 GTGGCAGCCTAGGAATAGAAGGG + Intergenic
935370914 2:102345782-102345804 GTGGCACCCCAGGAAGGCTGTGG + Intronic
935713515 2:105919530-105919552 GTGGAAGGCCTGGAATGAGGAGG - Intergenic
936443376 2:112575571-112575593 ATGGCAGACCAAGAAGGGGGTGG - Exonic
936472748 2:112813384-112813406 ATGACAGCCCTGGAATGGGCTGG - Intergenic
936542992 2:113367126-113367148 GTACCATCCCAGGAATGAGGAGG - Intergenic
937011258 2:118564902-118564924 ATGGCTGCCCAGGGATGGGGAGG - Intergenic
937247549 2:120503365-120503387 GTGGCAGGCCATGGATGGGTGGG - Intergenic
937556974 2:123170134-123170156 TCAGTAGCCCAGGAATGGGGAGG + Intergenic
938063107 2:128267380-128267402 CTGGCAGCCCAGGAGTGGGGAGG - Exonic
940323240 2:152399298-152399320 GTGGCAGCACAGGATGAGGGAGG + Intronic
943658752 2:190535126-190535148 GTGACAGCCCGTGAATGGGAAGG + Intergenic
944491458 2:200262483-200262505 CTGGCAGCCTAGGCATGTGGTGG + Intergenic
945129911 2:206559858-206559880 GTGGAAGGACAGGAAGGGGGAGG - Intronic
945746626 2:213726147-213726169 GTGGCAGTCCAGAAATGATGGGG + Intronic
946250042 2:218406269-218406291 GGGGCAGTCCTGGAATGCGGCGG + Intergenic
947179990 2:227403249-227403271 GAGGAAACCCAGGAAGGGGGTGG + Intergenic
948051370 2:234981945-234981967 GTGGCCACCCAGGAAGGAGGCGG - Intronic
948456399 2:238106501-238106523 GAGGCAGCCCCGGGGTGGGGAGG - Intronic
1170613241 20:17930392-17930414 GTGGTGGCCCAGGCGTGGGGAGG - Intergenic
1170644938 20:18189720-18189742 GTGGCAGTGCAGTAATAGGGCGG - Intergenic
1170702106 20:18712996-18713018 GTGGAAACCCAGGACAGGGGAGG - Intronic
1170826354 20:19799465-19799487 GTGGAGGACCAGGAATGGGAAGG + Intergenic
1171331230 20:24340358-24340380 GTGGAAGCCCAGGACTTGGGTGG - Intergenic
1171333170 20:24359141-24359163 CTGGCAGCACAGGAGTGGCGGGG + Intergenic
1172006972 20:31824373-31824395 GTGGCTGCCCAGGATGGGGAGGG + Intronic
1172776925 20:37413381-37413403 GTGCAGGCCCAGGAAAGGGGTGG - Intergenic
1173871343 20:46343993-46344015 GGGGCAGCCCAGGAACAGGATGG + Intergenic
1174280648 20:49436656-49436678 GTGGCTGCCCAGGGCTGGGATGG + Intronic
1174500523 20:50980949-50980971 GAGGCAGCCCAGGCAGGTGGAGG + Intergenic
1175539447 20:59739135-59739157 GTGGGAGCCCAGGAAATGTGTGG - Intronic
1175831128 20:61965940-61965962 GTGGCAGGCCAGGGGAGGGGCGG - Intronic
1178639822 21:34337014-34337036 GTGCCAGCCCAGGGAGGGGAGGG - Intergenic
1178942964 21:36922967-36922989 GTGTCAGCTCAGGAATGTCGGGG - Intronic
1179025786 21:37677200-37677222 GTGACAGCCTGGGGATGGGGAGG + Intronic
1179242127 21:39601887-39601909 GAGGGAGACCAGGCATGGGGTGG + Intronic
1180174738 21:46082119-46082141 GAGGCAGCCTGGGAATAGGGAGG + Intergenic
1180835390 22:18927063-18927085 GGGGCTGCCCAGGAGTGGGTGGG - Intronic
1181304253 22:21905650-21905672 GTGCCAACCCATGAATGGAGAGG - Intergenic
1181711978 22:24696676-24696698 GGGGCTGCCCAGGAGTGGGTGGG - Intergenic
1181836868 22:25617603-25617625 GTGGCTGCCCAGGGCTGGGGTGG - Intronic
1182068880 22:27449324-27449346 CTGGCTGCCCAGGCATGGGAGGG + Intergenic
1182283523 22:29231444-29231466 CTGGCAGCCCTGGGGTGGGGGGG - Intronic
1182567767 22:31212601-31212623 GTGGGACTCCGGGAATGGGGAGG + Intronic
1183485647 22:38086425-38086447 GTGGCTGCCCCGGAGTGGGTAGG + Exonic
1183627593 22:39014205-39014227 GTGCCTGAGCAGGAATGGGGAGG + Exonic
1184249231 22:43250796-43250818 GTGGGACCCCTGGAATGGGCTGG + Intronic
1184274958 22:43404908-43404930 CTGGCAGGAGAGGAATGGGGTGG + Intergenic
1184301277 22:43562597-43562619 GAGGCAGCCCAGGTCAGGGGTGG + Intronic
1184301310 22:43562676-43562698 GAGGCAGCCCAGGTCAGGGGTGG + Intronic
1184301343 22:43562755-43562777 GAGGCAGCCCAGGTCAGGGGTGG + Intronic
1185062880 22:48616149-48616171 GGGGCTGCTCAGGAGTGGGGTGG + Intronic
1185128613 22:49025230-49025252 GGGGCAGCCCGGGAGTGGGGAGG + Intergenic
1185163967 22:49246522-49246544 GTGGCTGCCCAGAAATGGGAAGG - Intergenic
1203285478 22_KI270734v1_random:152362-152384 GGGGCTGCCCAGGAGTGGGTGGG - Intergenic
950125365 3:10506858-10506880 GTGCCAGCCCAGGGATGGAGCGG - Intronic
950143664 3:10632824-10632846 GTGACAGCCCCGGAATAGTGAGG + Intronic
950177388 3:10884635-10884657 ATGCCAGCCCAGGACTGGGCAGG - Intronic
950458421 3:13106255-13106277 GTGGGAGCCCAGGAAGGTGCTGG - Intergenic
951812453 3:26715756-26715778 GTGGGAGCCCAGGAACTGGCAGG - Intergenic
952963885 3:38609401-38609423 GTGTCAGCTTAGGAAAGGGGTGG - Intronic
953316477 3:41931894-41931916 GTGGCAGCAGAGGAAGGAGGAGG - Exonic
956151306 3:66245979-66246001 GTGGTTGCCTAGGAGTGGGGAGG - Intronic
957959285 3:87227951-87227973 CTGGCAGTCTCGGAATGGGGAGG + Intronic
958673139 3:97230795-97230817 GTGGCGGAGCAGTAATGGGGAGG + Intronic
961639761 3:128357791-128357813 GTGGCCCCCCAGGGGTGGGGGGG + Intronic
962464906 3:135649149-135649171 GTGCCAGCAAAGCAATGGGGAGG + Intergenic
962742639 3:138373088-138373110 GTGGCAGCCCTGCATTGGGTGGG + Intronic
963598902 3:147360397-147360419 GTGGCAGTTCTGGGATGGGGAGG - Intergenic
963742888 3:149097793-149097815 CTGGCAGCACAGGATGGGGGGGG + Intergenic
965551164 3:169966702-169966724 CTGGCGCCCCTGGAATGGGGAGG - Intronic
967979245 3:195055622-195055644 GTGGTAGCCCAGGCATAGAGAGG - Intergenic
968284961 3:197503096-197503118 ATGGCAGCCCAGGAAGGAGCAGG - Intergenic
968757347 4:2423631-2423653 GGGGCAGGCCATGAAGGGGGTGG + Intronic
969648620 4:8448973-8448995 GGGGCAGCACAGGGAAGGGGAGG - Intronic
969691882 4:8708474-8708496 GTGGGAACCCTGGGATGGGGTGG + Intergenic
970626443 4:17889719-17889741 GAGAAAGCCCAGGAATGGTGGGG + Intronic
971059697 4:22953831-22953853 ATTGCAGCTCAGGGATGGGGTGG + Intergenic
971802491 4:31309918-31309940 GTGGTAGACAAGGAGTGGGGAGG + Intergenic
972730366 4:41788650-41788672 GTGGAACCCCAGGAGTGAGGTGG - Intergenic
972948033 4:44282428-44282450 GTTGTACCTCAGGAATGGGGAGG - Intronic
975947843 4:79729307-79729329 GTGGCAGCACAGGGGTGGAGGGG + Intergenic
976311257 4:83615472-83615494 GTGGCAGTTCAGGCATGTGGGGG + Intergenic
977666293 4:99650144-99650166 GTGGCAGCTGAGGAGTTGGGGGG + Exonic
981751424 4:148095765-148095787 GTGCCTGCCCAGGAATGGGCTGG + Intronic
982213309 4:153058579-153058601 GAGGCTGCCCAGGGATGGGCAGG + Intergenic
984866818 4:184288054-184288076 GAGGAAGCTCAGGAATGGGGTGG - Intergenic
984999696 4:185471312-185471334 GTGGGGGCAGAGGAATGGGGCGG + Intronic
985716602 5:1466654-1466676 GTGGGAGCCCAGGACAGGAGTGG - Intronic
985808726 5:2067970-2067992 GTGACAGCCCAGGGGTGGGGAGG + Intergenic
986794795 5:11199494-11199516 GTGGCATCCCAGCACTGGTGAGG - Exonic
986874281 5:12088144-12088166 GTGGCAGCTCAGAAGTGGAGTGG + Intergenic
988615711 5:32772869-32772891 GTGGCAGAACTGGAAAGGGGGGG + Intronic
990793909 5:59518455-59518477 GTGGCTGCCCAGGAGGAGGGGGG + Intronic
992684754 5:79188403-79188425 GTGGTAGCAGAGGAATGGGTGGG + Intronic
995017864 5:107332125-107332147 GTGGCAGCTCAGGAATAAGGAGG + Intergenic
996915372 5:128706210-128706232 GAGGCAGCACAGGAATAGGCAGG + Intronic
998383480 5:141742367-141742389 GAGGCAGCCCAGGGAGGGAGAGG + Intergenic
998405782 5:141874095-141874117 TTGGCAGTCCAGGAATGGTGGGG - Intronic
1000183665 5:158838151-158838173 GCGCCTGGCCAGGAATGGGGAGG - Intronic
1002080341 5:176733737-176733759 GTGGCAGCCCACGCGTGGAGCGG + Intergenic
1002104940 5:176875374-176875396 GGGGGAAGCCAGGAATGGGGAGG - Intronic
1002606933 5:180389229-180389251 GTGTCAGCACAGGGATCGGGTGG - Intergenic
1002830683 6:817645-817667 GTGGCTGCCAAGGACTAGGGAGG - Intergenic
1003264251 6:4551619-4551641 GTGACAGCCCAGGAAGAGGAAGG - Intergenic
1003302999 6:4901935-4901957 GTGGCAGCCCAGAGCTGCGGGGG - Intronic
1006419638 6:33925039-33925061 GTGGCTTCCCAGGAATCAGGTGG - Intergenic
1006450807 6:34104729-34104751 GTGGCACCCAAGGGATGTGGTGG - Intronic
1006798660 6:36745943-36745965 GTGGGAGCCAGGGAAAGGGGTGG + Intronic
1007416381 6:41693838-41693860 GTAGCAGCATAGGAAGGGGGTGG - Intronic
1010907523 6:81509920-81509942 GTGGCTGCCAGGGGATGGGGTGG - Intronic
1011149325 6:84252791-84252813 CTTCCAGCCCAGAAATGGGGAGG - Intergenic
1011736214 6:90313219-90313241 GTGGAGGCCCAGGGCTGGGGTGG + Intergenic
1012146892 6:95695348-95695370 GTGGCTGCGGAGGAGTGGGGAGG + Intergenic
1012956052 6:105571361-105571383 GTGGTATCCCAGAAATGGTGAGG + Intergenic
1013225477 6:108117303-108117325 ATGGCAGGTCAGGAGTGGGGAGG - Intronic
1014617134 6:123617180-123617202 GTGCCAGCCCAGGAACGTGAAGG + Intronic
1015964816 6:138687807-138687829 GTGGTTGCCTAGGAATGGGAGGG + Intronic
1017824448 6:158071247-158071269 ATGGCTGCACAGGAGTGGGGTGG + Intronic
1018391536 6:163345152-163345174 GGGGCAGCCCAGGAAGAGTGTGG + Intergenic
1019494705 7:1332338-1332360 GCAGCGGTCCAGGAATGGGGTGG + Intergenic
1019501826 7:1368675-1368697 GAGGCCGCTCAGGAACGGGGGGG - Intergenic
1019924162 7:4181438-4181460 GAGACAGCCCAGGTGTGGGGAGG + Intronic
1020513154 7:9084752-9084774 GTGGGAGCACAGGAAGGGGCAGG - Intergenic
1021653434 7:22853306-22853328 CTGTAAGCCCAGGAATGCGGTGG - Intergenic
1021658016 7:22891022-22891044 GTGGCTGCCCCGAGATGGGGTGG - Intergenic
1022967618 7:35487993-35488015 GAGGGAGCCTAGGCATGGGGAGG - Intergenic
1023071295 7:36437150-36437172 GTGGCTGCCAGGGAGTGGGGAGG - Intronic
1024094019 7:45970131-45970153 GTGGCTGCCCAGGCAGGGGGTGG + Intergenic
1026905625 7:74061189-74061211 CTGACAGCACAGGACTGGGGTGG + Intronic
1027190338 7:75992689-75992711 GTGCCTGCCCAGGGATGAGGTGG + Intronic
1027453356 7:78358503-78358525 CTGGGGGCCCAGGAATGGCGGGG - Intronic
1029527421 7:101103558-101103580 GAGGCAGCCTAGGACTGGGCAGG + Intergenic
1031330110 7:120453465-120453487 GTGGCAGTGCAGGATTGGGTGGG - Intronic
1032559648 7:132875292-132875314 GTGTTCGTCCAGGAATGGGGTGG - Intronic
1034264232 7:149773470-149773492 GTGGGAGCTCAGGACGGGGGAGG + Exonic
1034329363 7:150269413-150269435 GTGGGAGCCCACGGGTGGGGGGG - Intronic
1034533228 7:151710401-151710423 GTGGCAGCGGAGCAAAGGGGAGG - Intronic
1035117999 7:156540917-156540939 GTGGCAGGCCAGGAAGCAGGTGG + Intergenic
1035354825 7:158270694-158270716 GGGGCAGCCCAGTAGAGGGGTGG - Intronic
1036527764 8:9551139-9551161 GTGGCAGCCCAGGCAGTGAGAGG - Intergenic
1037162361 8:15788978-15789000 CTGGCAGCTGAGGAAAGGGGAGG - Intergenic
1038681678 8:29674224-29674246 TTGTCTGCCCAGGAATGGGTGGG - Intergenic
1039945832 8:42128404-42128426 GGGGCAGCCCAGGAATGGGCAGG + Intergenic
1040518013 8:48150127-48150149 TTCACAGCCCAGGAATGGTGTGG - Intergenic
1040552712 8:48450785-48450807 CTGGCAGCCTAGGGATGTGGGGG + Intergenic
1043305139 8:78784323-78784345 CTGGAAGTCCAGGATTGGGGTGG - Intronic
1047758463 8:127936514-127936536 GTGTCAGACCAGCATTGGGGCGG - Intergenic
1048199096 8:132356788-132356810 GTGATGGCCCAGGAATGGGATGG + Intronic
1048448516 8:134511086-134511108 AGCACAGCCCAGGAATGGGGTGG + Intronic
1049170913 8:141160066-141160088 GTGGCAGGACAGGAATGAGCTGG + Intronic
1049238285 8:141523780-141523802 GGGCCAGCCCAGGACTCGGGTGG - Intergenic
1049570986 8:143370218-143370240 GTGGCAGCCCAGGGAGGGCCAGG - Intronic
1049578794 8:143401529-143401551 GAGGCGGCCCAGAGATGGGGAGG + Intergenic
1050264307 9:3874002-3874024 GTTGTATGCCAGGAATGGGGAGG - Intronic
1052249124 9:26376201-26376223 GTGGCTGCCCAGGGCTGGGCAGG + Intergenic
1053374580 9:37594506-37594528 GAGGCAGCTCTGGAATGGGAGGG + Intronic
1056217168 9:84416110-84416132 GTAGCAGCCCAGGGGAGGGGAGG - Intergenic
1056581285 9:87889360-87889382 GTGGTAGCCTGGGAATGTGGGGG + Intergenic
1056997129 9:91473422-91473444 GTGGCAGCCTAGGCTGGGGGAGG - Intergenic
1058826256 9:108778358-108778380 GTGGGAGCACAGGATTGGGTGGG + Intergenic
1060680422 9:125558097-125558119 GAGGCAGGCCAGGATTTGGGAGG - Intronic
1060790583 9:126483054-126483076 GCGGCAGCTCAGGGATGGGAGGG - Intronic
1060940737 9:127541690-127541712 CTGGCAGGCCAGGAAGGAGGAGG + Intronic
1061185424 9:129050005-129050027 TTGGCAGCACAGGAGAGGGGCGG + Intronic
1061750813 9:132775782-132775804 GAGGCAGCCGAGGATTGGGAGGG - Intronic
1061800846 9:133112742-133112764 TTGGCAGCCCAGGTCTGGGCAGG + Intronic
1062032086 9:134366309-134366331 CTGGCAGGGCAGGCATGGGGGGG - Intronic
1062199921 9:135297155-135297177 CAGGCAGCCCAGGAGTGGTGGGG - Intergenic
1062229802 9:135475646-135475668 GTGGAAGGCCAGCAAGGGGGAGG - Intergenic
1062290319 9:135791516-135791538 GTGGCATCGCAGCAAAGGGGTGG - Intronic
1062381234 9:136287788-136287810 GTGGCTGCCAAGGGCTGGGGAGG + Intronic
1062484949 9:136770050-136770072 GAGGCTGCCCAGGGAAGGGGAGG - Intergenic
1189058779 X:37729260-37729282 CTGACAGGCAAGGAATGGGGAGG - Exonic
1190029912 X:46962129-46962151 GTGGCTGCCCAGGAAGATGGAGG + Intronic
1190773812 X:53536802-53536824 AGGACAGCCCAGAAATGGGGTGG + Intronic
1194051896 X:89079581-89079603 GTGGCTGCTCAGGGAGGGGGAGG - Intergenic
1196927573 X:120648546-120648568 GTTGCAGCTCAGGGGTGGGGAGG + Intergenic
1199146869 X:144379259-144379281 GTGACAGCCCAGGATAGGGGAGG + Intergenic
1199314702 X:146363304-146363326 GTACCAGCTCAGGAAAGGGGGGG - Intergenic