ID: 1137577101

View in Genome Browser
Species Human (GRCh38)
Location 16:49607425-49607447
Sequence CTGTGTATGTTGATGTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137577099_1137577101 -2 Left 1137577099 16:49607404-49607426 CCCAAAGCTATGGGTTCTTTACT 0: 1
1: 0
2: 3
3: 11
4: 157
Right 1137577101 16:49607425-49607447 CTGTGTATGTTGATGTTTGATGG 0: 1
1: 0
2: 3
3: 22
4: 295
1137577100_1137577101 -3 Left 1137577100 16:49607405-49607427 CCAAAGCTATGGGTTCTTTACTG 0: 1
1: 0
2: 2
3: 10
4: 106
Right 1137577101 16:49607425-49607447 CTGTGTATGTTGATGTTTGATGG 0: 1
1: 0
2: 3
3: 22
4: 295
1137577098_1137577101 5 Left 1137577098 16:49607397-49607419 CCTTTTTCCCAAAGCTATGGGTT 0: 1
1: 0
2: 2
3: 10
4: 194
Right 1137577101 16:49607425-49607447 CTGTGTATGTTGATGTTTGATGG 0: 1
1: 0
2: 3
3: 22
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137577101 Original CRISPR CTGTGTATGTTGATGTTTGA TGG Intronic
901755116 1:11436821-11436843 CTGTCTATGCTGATGTTGAAGGG - Intergenic
902365772 1:15973206-15973228 CTGTATTTGTCTATGTTTGATGG - Intronic
906143206 1:43545799-43545821 CTGTGTGTGTTTGTGTTGGAGGG + Intronic
906867002 1:49432800-49432822 TTTTGTATGTTAATGATTGATGG + Intronic
908670252 1:66538837-66538859 TTTTGGATGTTGCTGTTTGAAGG + Intronic
909106474 1:71415902-71415924 GTGTGTATGTGGATGTGTGTGGG + Intronic
909374763 1:74927106-74927128 CTGGGTTTGTTGATTTTTGAAGG - Intergenic
909545580 1:76842915-76842937 CTGTGAATTTTGATATCTGAGGG - Intergenic
909971012 1:81989727-81989749 CTGTCTATCGTGATGTTGGATGG + Intronic
910770575 1:90827150-90827172 CTGTGAAAGTTGGAGTTTGAGGG + Intergenic
912142814 1:106752268-106752290 CTGTATATTTTGATGTGAGAAGG - Intergenic
913443848 1:118928570-118928592 CTGTATATGTAAATGTTTGGAGG + Intronic
914349299 1:146826545-146826567 CTGTGTCTGTTGATGTTTTAGGG - Intergenic
915873084 1:159582641-159582663 CTTTGTATTTTGAAGTTTTAGGG + Intergenic
916321200 1:163506317-163506339 CTGTGTATGTTGAAACTTGGAGG + Intergenic
917610970 1:176688851-176688873 CTGTGTATGTGGTTGTCTAAGGG + Intronic
919928415 1:202205563-202205585 GTGTGTATGTGTATGTTTGAAGG - Intronic
920016954 1:202919634-202919656 CTATGGATGTTCATGTTTGCTGG - Intronic
920711712 1:208301702-208301724 GTGTGTGTGTTTATGTGTGAAGG + Intergenic
921205246 1:212843090-212843112 GTGTGTGTGTGTATGTTTGACGG - Intronic
921421207 1:214950946-214950968 ATGTGTTTTTTGGTGTTTGATGG + Intergenic
921516794 1:216102948-216102970 GTGTGTATGTTTCAGTTTGAAGG - Intronic
922184249 1:223259916-223259938 CTGTGTATTTTGAAGTGTGGTGG - Intronic
924201731 1:241667411-241667433 GTGTCTATGTTCATGTTTGATGG - Intronic
924210590 1:241762961-241762983 CTGTGTATATTGATTTTAAAGGG - Intronic
924876320 1:248108521-248108543 CTGTGTTTATTGATTTTTGAAGG + Intergenic
1062886853 10:1023106-1023128 CTGTGTCCGTGGAGGTTTGAAGG + Intronic
1064036935 10:11921655-11921677 CTGTGCATTTTGGTGTCTGAGGG + Intronic
1064207866 10:13339649-13339671 CTGTGGATGTTGGTGTCTGTGGG - Intronic
1064365360 10:14702803-14702825 CAGTGTCTGTTGATCTTTGAGGG - Intronic
1066027447 10:31375648-31375670 CTGTGTATGTTGGAGTGTAATGG + Intronic
1066491959 10:35902484-35902506 CTGTGTCTGGGGAAGTTTGATGG + Intergenic
1066509488 10:36080545-36080567 CTGGATTTGTTGATTTTTGAAGG + Intergenic
1068071295 10:52199488-52199510 CTGTGTTTGTTTATATTTTAGGG + Intronic
1068542897 10:58315100-58315122 GTGTGAAAGTGGATGTTTGATGG + Intergenic
1068654655 10:59562381-59562403 CTGTGGCAGTTGATGCTTGATGG + Intergenic
1069328987 10:67267669-67267691 CTGTTTTTCTTGATGTTTCAAGG - Intronic
1069543464 10:69312852-69312874 CAGTGTCTGTTGATCTTTAAGGG + Intronic
1070663965 10:78330451-78330473 ATGTGTATGTTTAAGATTGAGGG - Intergenic
1071748806 10:88451728-88451750 ATGTGTATATTGAGGGTTGATGG - Intronic
1071933239 10:90497151-90497173 CTCCATATGTTGATGTTTGATGG - Intergenic
1073493554 10:103871611-103871633 TTGTGTATGTGTATGTTTGTAGG - Intergenic
1073555655 10:104448227-104448249 CTGTGTATGTTTATTTCAGATGG - Intronic
1073937953 10:108657523-108657545 CTGTGTATGTAGAAATTTTATGG + Intergenic
1078798617 11:14620084-14620106 ATGTGTATGTGTATGTTTAAAGG + Intronic
1079162357 11:18006875-18006897 CTGTGTATGTTCATGTATTCTGG + Intronic
1079406134 11:20147631-20147653 CTGTGGATTTTGATATCTGAAGG + Intergenic
1081850067 11:46269566-46269588 CCATGCATGCTGATGTTTGAAGG + Intergenic
1084522689 11:69674259-69674281 CTGTGTATGTTGCAGTTTTTTGG - Intronic
1084942710 11:72621670-72621692 CTGTGTCTGATGCTGTGTGAGGG - Intronic
1088105629 11:106203846-106203868 CTGTGTCTGCTCATGGTTGAAGG - Intergenic
1089710426 11:120310619-120310641 CTGGGGATGGTGATGGTTGAAGG + Intronic
1090548248 11:127789817-127789839 CTGTGCATGTTGGTGTTACAGGG - Intergenic
1091196920 11:133739119-133739141 GTGTGTATGTGGGTGTTTGGGGG + Intergenic
1092657069 12:10697296-10697318 CTGTGGTTGTTCATATTTGATGG - Intergenic
1093244474 12:16719228-16719250 CTTTGTATGTTTATGTTTTGGGG + Intergenic
1093764210 12:22943856-22943878 CAGTGTCTGTTGATTTTTAAAGG + Intergenic
1095580007 12:43786951-43786973 CTGTGTTTGGTGATGCTTGAAGG - Exonic
1096859424 12:54513496-54513518 CTGTGTATGTTGATATTTAAGGG + Intronic
1097305691 12:58066821-58066843 CTGTGGATTTTGGTATTTGAAGG + Intergenic
1099219060 12:79890773-79890795 ATGTGTATGCTTATGTCTGATGG - Intronic
1099938396 12:89155629-89155651 TTGTGTGTGTTTATGTTGGAGGG + Intergenic
1100864538 12:98842895-98842917 CTATGTATGTATATTTTTGAGGG + Intronic
1101973567 12:109335214-109335236 CTGTGAATATTGATGTTTCTGGG + Intergenic
1104242768 12:127006902-127006924 ATGTGTGTGTAGATGTTTGTAGG - Intergenic
1105330295 13:19409822-19409844 CTGTGCATGTTTATAGTTGAAGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106224281 13:27773473-27773495 TTGTGGATCTTGATGTGTGAAGG - Intergenic
1106969471 13:35120914-35120936 CTAGGTATGTAGATGTGTGATGG + Intronic
1107020202 13:35743432-35743454 CAGTGTCTGTTAATCTTTGAGGG + Intergenic
1107575707 13:41719449-41719471 ATGTATATGTTGCTGTTTGCTGG - Intronic
1107871726 13:44752833-44752855 GTGTGTATGTCGTTGTGTGATGG - Intergenic
1107872024 13:44755741-44755763 CTGGGCATGGTGATGTGTGACGG - Intergenic
1108758426 13:53532433-53532455 CTGGGTTTGGTGAGGTTTGACGG - Intergenic
1109135710 13:58647805-58647827 ATGTGTTTGTTTATGTTTGAAGG - Intergenic
1109781533 13:67116704-67116726 TTGTGTATATTGATGGTGGATGG - Intronic
1111070072 13:83154384-83154406 CTGTGTATGTTGCATTTTAAGGG - Intergenic
1111108620 13:83677275-83677297 ATGTGTATGTATATGTGTGATGG + Intergenic
1115190538 14:30743314-30743336 GTGTGTATGCTGCTGTTTTAGGG - Intergenic
1119624407 14:76159756-76159778 CTGTGTGTATTTGTGTTTGAGGG - Intronic
1121956086 14:98214753-98214775 CTGTGTGTGTTGGTGTTGGTGGG + Intergenic
1123901017 15:24877375-24877397 CTGTTTCTGTTGATGCTAGATGG - Intronic
1126956505 15:53938535-53938557 ATGTGTATTTTGTTGTTTGGGGG - Intergenic
1127249361 15:57214323-57214345 CTGTTCATGTTGATGTCGGAGGG + Intronic
1127542957 15:59961174-59961196 CTGTGTTTGTTGATTTTTTTTGG - Intergenic
1128599841 15:68987032-68987054 CAGTGTGGGTTGATTTTTGAAGG + Intronic
1131050504 15:89344389-89344411 TTGTGTGTTTTGATGTTTGTTGG - Intergenic
1133414426 16:5595278-5595300 CTGTATTGGATGATGTTTGATGG + Intergenic
1134491028 16:14695268-14695290 GTGTGTATGTTTGTGTGTGATGG - Intergenic
1134496409 16:14734386-14734408 GTGTGTATGTTTGTGTGTGATGG - Intronic
1136104212 16:28017657-28017679 TTGTGCATGTTGATGTGTGCAGG - Intronic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1137577101 16:49607425-49607447 CTGTGTATGTTGATGTTTGATGG + Intronic
1139197857 16:64941909-64941931 CTGAAAATATTGATGTTTGAAGG - Intergenic
1139389220 16:66595387-66595409 ATGTGTATTTTGCTGTTGGATGG - Intergenic
1139984737 16:70889009-70889031 CTGTGTCTGTTGATGTTTTAGGG + Intronic
1140647923 16:77053261-77053283 TTGTGTATGTTTATGTGTGTTGG + Intergenic
1145876453 17:28321894-28321916 GTGTGTGTGATGATGTTTGAAGG + Intronic
1148682076 17:49479944-49479966 CTGTGTGTGTTTATGTGTGTTGG - Intergenic
1150241821 17:63640417-63640439 GTGTGTACGTTGATTTTTGCAGG + Intronic
1153240729 18:3029293-3029315 CTGTGTGTGTTGTGTTTTGAGGG - Intergenic
1154229240 18:12539560-12539582 GTGTGTATGTGTATGTTTAAGGG - Intronic
1154285086 18:13047350-13047372 GTGTGTGTGTGTATGTTTGAGGG - Intronic
1156794673 18:41029500-41029522 TTGTATTTTTTGATGTTTGAAGG + Intergenic
1156799636 18:41094287-41094309 CTGTGGATTTTGATATTGGAGGG + Intergenic
1157141202 18:45108808-45108830 CTGTGTTTGTGGTTGTCTGACGG - Intergenic
1158568764 18:58578912-58578934 CTGAGTCTGTTGAAGTTTGAAGG + Exonic
1159785065 18:72704148-72704170 CTGTGTCCGTTGATGTTTCCAGG - Intergenic
1161895759 19:7078792-7078814 ATGTGTATTCAGATGTTTGATGG + Intronic
1162710894 19:12593944-12593966 CTGTGTAGGTTGCTGTTTCTAGG + Intronic
1163194363 19:15704230-15704252 CTGTTTCTGTTGGTGTTGGAAGG - Intergenic
1165157986 19:33799417-33799439 CAGTGTCTGTGGATGTGTGAAGG + Intronic
1165161397 19:33818874-33818896 CTTTGGATGTTGATTTTTAAAGG + Intergenic
1166246084 19:41527440-41527462 CTGTGTATGTAGTTTTTTCAGGG - Intergenic
925156920 2:1655982-1656004 GTGTGTATCTATATGTTTGATGG - Intronic
926110787 2:10182485-10182507 CTGTGTATATTTATTTTTTAGGG - Intronic
929359893 2:41074800-41074822 CTGTGTCCGTTGATGTTTCCAGG + Intergenic
931937337 2:67213869-67213891 CTGTGGGTGTTTATGTTTGTGGG - Intergenic
932543778 2:72685666-72685688 CTGTGTGTGTTTTTGTTAGAAGG - Intronic
932815641 2:74859262-74859284 CTATGTATGCTGAAGTTTTAGGG + Intronic
933534509 2:83555263-83555285 CTGTATTTATTGATTTTTGAAGG + Intergenic
937495238 2:122412245-122412267 CTGAGTATGCTGATGTGGGAGGG + Intergenic
937503777 2:122513366-122513388 GTGTGTATGTGGATGTGTGTAGG + Intergenic
938807691 2:134822197-134822219 CTGTGTGTGTTGATGATGGGAGG - Intergenic
939292162 2:140210623-140210645 CTGTTCTAGTTGATGTTTGATGG + Intergenic
939828055 2:147039455-147039477 CTCTCTATGTTGATGTCTAAAGG + Intergenic
941644659 2:168027077-168027099 CTGAGTTTGTTGAGGTTGGAGGG + Intronic
944168458 2:196748821-196748843 GTGTGTGTGTTGATGATTGTGGG - Intronic
944486604 2:200213381-200213403 CTGTTTATTTTTATGTTTCAAGG + Intergenic
944595165 2:201254606-201254628 CTGTGAGTGTTTATCTTTGAAGG + Intronic
944863747 2:203840465-203840487 GTGTGTGTGTTGATGCATGAGGG + Intergenic
944924465 2:204450199-204450221 CTCTGTCTCTTGATGCTTGATGG + Intergenic
945779139 2:214146243-214146265 CTGTGTAGTTTGAGTTTTGAGGG - Intronic
948353486 2:237359688-237359710 CTCTGTTTGCTGAAGTTTGAAGG - Intronic
948594415 2:239070218-239070240 CTGTGTGTGTTGGTGTTCCAGGG - Intronic
1170188034 20:13614341-13614363 CTACGTATGTTGTTGTGTGAGGG - Intronic
1173436423 20:43035938-43035960 CAGTGTATGTTTATGGTTCAGGG - Intronic
1174061172 20:47834035-47834057 CTGTGTCCGTTGAAGTTTGAGGG - Intergenic
1174070604 20:47896664-47896686 CTGTGTCCATTGAAGTTTGAGGG + Intergenic
1174100495 20:48123065-48123087 CTGTGTTAGTTGAAGTTTGAGGG - Intergenic
1174153446 20:48501938-48501960 CTGTGTCAGTTGAAGTTTGAGGG - Intergenic
1174153534 20:48502445-48502467 GTGTGTCAGTTGAAGTTTGAGGG - Intergenic
1174654627 20:52160374-52160396 CTGTGTGTGTATGTGTTTGAAGG - Exonic
1174657807 20:52186237-52186259 CTGTGTGTGTAGGTGTTTGTGGG + Intronic
1174706644 20:52663131-52663153 TTCTGAATGTTGATGTTTGAAGG - Intergenic
1176221823 20:63973119-63973141 TTGTGTGTGTTGGTGTTTGCTGG + Intronic
1176697813 21:10001958-10001980 CTGTTTCTGTTGAGATTTGATGG + Intergenic
1177057357 21:16323251-16323273 CTGTGAATTTTGATGTTTGGAGG + Intergenic
1177696294 21:24576967-24576989 CTGTGAATGTTGATGTGGGCTGG + Intergenic
1179317304 21:40255189-40255211 CTGTGTATGTTACTGTGTGCTGG + Intronic
1182279774 22:29211224-29211246 GTGTGTATGTGAATGTGTGAGGG + Intronic
1183850829 22:40586351-40586373 CTTTGTATCTTCATGGTTGATGG - Intronic
1184713740 22:46268446-46268468 GTGTGTGTGTTGAAGTTTGAAGG + Intronic
1184990628 22:48167034-48167056 CTGTGTGTGTGCATGTATGAAGG - Intergenic
1185153128 22:49177891-49177913 CTGAGTTGGTTGATGTTTGCCGG - Intergenic
949126732 3:454089-454111 CTGTGGATTTTGGTGTTTTAGGG + Intergenic
950433370 3:12964568-12964590 CTGAGAATGTGGATGTCTGAAGG - Intronic
951397751 3:22190726-22190748 CTGTGTATGGATATGTTTCAAGG - Intronic
952002538 3:28803077-28803099 CTGTGTATGTTTCTGTGTGGAGG + Intergenic
954529407 3:51305029-51305051 GTGTGTATTTTGTTGTTAGATGG + Intronic
955113030 3:55968254-55968276 TTTTCTATGTTGCTGTTTGAAGG + Intronic
955392051 3:58529111-58529133 GTGTGGATGTTCATGTTAGATGG - Intronic
955528711 3:59849555-59849577 CTGTGTCTGTTTATATTTGTGGG - Intronic
956235473 3:67065887-67065909 CAGGATATGTTGATGTTTTAAGG - Intergenic
957023010 3:75144889-75144911 CTGTATATGTTGAACTTTAATGG + Intergenic
957307545 3:78477599-78477621 CAGTGTATGTTGAACTTTAAAGG - Intergenic
957790999 3:84941135-84941157 CTGTGTGTGTTTGTGTGTGACGG - Intergenic
957828358 3:85481182-85481204 CTGTGTATGTGGGTGTATAATGG - Intronic
958083606 3:88778770-88778792 TTGTGTATCTTGATTTTTTAAGG - Intergenic
958158292 3:89784333-89784355 CCATGTATGTTAATTTTTGAGGG - Intergenic
958268458 3:91468345-91468367 CTTTCTATGTTGATGTTTTTAGG - Intergenic
959903957 3:111690315-111690337 ATGAGGATGGTGATGTTTGAAGG + Intronic
960262729 3:115586857-115586879 CTGTGTGTGGTGCTGTGTGAGGG - Intergenic
960569466 3:119171410-119171432 CTGTGTATGTTCATTTGAGAGGG - Intronic
961138379 3:124533941-124533963 CTCTCACTGTTGATGTTTGATGG - Intronic
961557615 3:127707296-127707318 CTGAGTATGTGGATGGCTGAGGG + Intronic
963389962 3:144648662-144648684 CTGTGTATATGTGTGTTTGAAGG - Intergenic
964871899 3:161321573-161321595 CTGTATTTCTTCATGTTTGAAGG - Intergenic
966422267 3:179745315-179745337 GTGTGTTTGTTCATGTGTGATGG + Intronic
966568968 3:181418615-181418637 TTATGTATGATGATGTTTTAAGG + Intergenic
967698715 3:192566707-192566729 GTGTCTATGTTCTTGTTTGAGGG - Intronic
967713282 3:192734117-192734139 CTGTGTATTTGGAATTTTGAGGG - Intronic
969223183 4:5774691-5774713 CTGTGTGTGCTTCTGTTTGAGGG + Intronic
970254382 4:14152254-14152276 GTGTGTTTGGTGATGGTTGAGGG + Intergenic
971005114 4:22364702-22364724 CTGTGGATGTGGCTATTTGAGGG + Intronic
971540962 4:27815828-27815850 CTGTGTATTCTACTGTTTGAGGG - Intergenic
972070060 4:35007767-35007789 CTGTGGATTTTGGTGTCTGAGGG - Intergenic
974277937 4:59750890-59750912 CTCTGTATATTAATGGTTGAGGG - Intergenic
974417882 4:61634577-61634599 CTGTGTGTTTTGATGTTCTAGGG - Intronic
976327687 4:83791443-83791465 ATGTCTAGGTTGCTGTTTGAAGG - Intergenic
976459566 4:85293573-85293595 ATGTGTATTCTGATGTTGGATGG - Intergenic
976709008 4:88049222-88049244 CTATGTATGTGTATGTTTTACGG - Intronic
978654941 4:111053445-111053467 CTTTGTTTCTTCATGTTTGAAGG - Intergenic
978940619 4:114432094-114432116 ATGTGTATTTTGTTGTTTGGGGG + Intergenic
979324039 4:119358168-119358190 GTGTGTATGTGCATGTATGAAGG + Intergenic
979803421 4:124940059-124940081 CTGAGTATGTTGACCTTTGCAGG + Intergenic
980370360 4:131861831-131861853 CTGTTTCTGTTGAGATTTGATGG + Intergenic
981285012 4:143006164-143006186 CTGTGTATCTTCATTTTTCAGGG - Intergenic
982114202 4:152083440-152083462 TAGTGTAGGTTAATGTTTGATGG + Intergenic
982141478 4:152324387-152324409 CTGTGTCTTTTGTAGTTTGATGG - Exonic
982854834 4:160368192-160368214 GTGTGTATGTATATATTTGAAGG + Intergenic
983241877 4:165242854-165242876 GTGTGTATGTGCATGTATGAAGG + Intronic
986479485 5:8171494-8171516 CTTTTTATGTTGATTTTTGGTGG + Intergenic
987525125 5:19038399-19038421 CTGTGGATTTTGATGTCTGTGGG - Intergenic
988700213 5:33666199-33666221 CTGTGTATGTTAACGGTGGAGGG - Intronic
988781469 5:34526487-34526509 CTGTGGATTTTGGTGTCTGAGGG - Intergenic
989160398 5:38385304-38385326 CTTTGGATGTTGGTGTTTGTTGG - Intronic
989998258 5:50861294-50861316 CTGTGTCTGTTGATGTTTCCAGG + Intergenic
990279560 5:54235238-54235260 CTCTGTATGTTAATGTTAAAAGG + Intronic
991000487 5:61777788-61777810 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
992246552 5:74830164-74830186 CTTTTTATGTTGTTGTGTGAGGG - Intronic
992956771 5:81917925-81917947 CTGTGTATATTGTTGCTTGAGGG - Intergenic
993100011 5:83526444-83526466 CTGTGTTGGTTAATGTTTGAGGG + Intronic
993198005 5:84775174-84775196 GTGTGTGAGTTGTTGTTTGAAGG + Intergenic
993987970 5:94619342-94619364 GTGTGTATGTTTGTGTTTAAAGG - Intronic
994190114 5:96859854-96859876 CAGGCTATGTTAATGTTTGAGGG + Intronic
994265873 5:97715659-97715681 CTGTGTGTGTGCATGTTTGGTGG - Intergenic
994356795 5:98801782-98801804 CTGTATTTGTTGAGTTTTGAGGG + Intergenic
994549698 5:101216105-101216127 GTTTGTTTGTTGTTGTTTGATGG - Intergenic
995178882 5:109211429-109211451 CTGAATTTGTTGATTTTTGAAGG + Intergenic
995397228 5:111699780-111699802 ATGTGTATGTATATGTTTGTGGG + Intronic
996862979 5:128085157-128085179 GTGGGAATGTTGCTGTTTGAAGG + Intronic
997707006 5:135965121-135965143 GTGTGTATGTGCATGTGTGAAGG - Intergenic
997790721 5:136758176-136758198 GTGTGTATTTTGTTGTTGGATGG - Intergenic
999486295 5:152000069-152000091 TTGAGTTTGTTGATATTTGAAGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003902374 6:10666799-10666821 CTGGATTTGTTGATTTTTGAAGG + Intergenic
1003908358 6:10722362-10722384 TTGTGTATGTTGATACTTGTAGG + Intergenic
1004509631 6:16274867-16274889 CAGTTTATGTGAATGTTTGAGGG + Intronic
1004944227 6:20594442-20594464 CTGTGTCTTTTGATCTTTGTTGG + Intronic
1007534383 6:42572351-42572373 CTCTGTATGTTGTTTTTAGAAGG + Intronic
1007992634 6:46273067-46273089 CTGTGTTTGTTTTTGTTTTAAGG + Intronic
1008986749 6:57553238-57553260 CTTTCTATGTTGATGTTTTTAGG + Intronic
1009174708 6:60445803-60445825 CTTTCTATGTTGATGTTTTTAGG + Intergenic
1009401946 6:63266940-63266962 CTGTGAAGAATGATGTTTGAGGG + Intergenic
1011935679 6:92774064-92774086 ATGTGTATATTAATGTTTTAGGG + Intergenic
1012058450 6:94446080-94446102 CTGTGTCAGTTGATGTTTCTGGG - Intergenic
1013603412 6:111726126-111726148 CTGATTATGTTGTTGTTTGAAGG - Intronic
1013935748 6:115590890-115590912 TTGTGTATGTGCATGTGTGAAGG - Intergenic
1014048459 6:116922922-116922944 CTGTCTTTGCTGATGTTTTAAGG - Intronic
1014613522 6:123573822-123573844 CTGTGTACATAGCTGTTTGAAGG - Intronic
1014757044 6:125312880-125312902 CTGTGTGTGTGCATGTTAGAGGG - Intergenic
1015221180 6:130805192-130805214 ATGTGTATGTTGTTGTTTTTGGG + Intergenic
1015462911 6:133513447-133513469 CTGTTTATATTTATTTTTGATGG - Intronic
1015646053 6:135389779-135389801 CTTTGCATGTTTATATTTGAAGG - Intronic
1016130837 6:140467520-140467542 ATGTGTATTTTGCTATTTGAGGG + Intergenic
1016633019 6:146254026-146254048 GTGTGTATGTATAAGTTTGAGGG + Intronic
1017410739 6:154165376-154165398 GTGTGCATGTTCATGTTGGAAGG - Intronic
1018783862 6:167092968-167092990 CAGTGTGTGTTGATGTTGGGGGG + Intergenic
1020365809 7:7379426-7379448 TGGTGTATGATGGTGTTTGAGGG - Intronic
1023052003 7:36261026-36261048 CTGTGGATTTTGGTATTTGAGGG + Intronic
1025233427 7:57218076-57218098 GTGTGTCAGTTGAAGTTTGATGG + Intergenic
1025233583 7:57218954-57218976 GTGTGTCAGTTGAAGTTTGAGGG + Intergenic
1027675882 7:81157941-81157963 ATGTGTATGTGTATGTTGGAGGG + Intergenic
1027920050 7:84381508-84381530 CTGTATGTTTTGATGTCTGAAGG - Intronic
1030087602 7:105830330-105830352 TTGTTGATGTTGTTGTTTGAAGG - Intronic
1030232732 7:107225032-107225054 CTGTGTGTGTGTATGTATGAGGG + Intronic
1030547755 7:110919038-110919060 CTGTGGCTGCTGCTGTTTGAAGG - Intronic
1030711107 7:112750275-112750297 ATGTGTCTGTTTATGTTTAAAGG - Intergenic
1031144051 7:117978229-117978251 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
1031330950 7:120463840-120463862 CTGTGCATGTTTATTATTGAAGG + Intronic
1031699851 7:124910798-124910820 CTATGTGTGTTTATGTTTGTTGG - Intronic
1031896573 7:127356481-127356503 ATGTGTATTTGGGTGTTTGAAGG - Intronic
1031967566 7:128038264-128038286 CTGTGTATGTGGATGCTAGTGGG + Intronic
1032930698 7:136665870-136665892 CTATATATTTTGAAGTTTGAAGG + Intergenic
1033773487 7:144580482-144580504 CTAGGTATGATGATGTTTCAAGG - Intronic
1034328149 7:150256852-150256874 CTGTGTATTTTGCTGTTTTGGGG - Intronic
1034765069 7:153712608-153712630 CTGTGTATTTTGCTGTTTTGGGG + Intergenic
1036982027 8:13480628-13480650 CTGTGTATCTTAATTTTTGTTGG - Intronic
1038190740 8:25318091-25318113 CTGTTGTTGTTGTTGTTTGATGG + Intronic
1038268689 8:26057156-26057178 CTGTTGATGTTGATGATTGGCGG + Intergenic
1038897556 8:31802956-31802978 CTGTCTTTGTTGATTTTTGTGGG + Intronic
1039620194 8:38989907-38989929 CTGTGTATGTAGATTTTTCTGGG + Exonic
1041889551 8:62853662-62853684 CTGGATTTGTTGATTTTTGAAGG + Intronic
1042381458 8:68119026-68119048 ATGTGGATGTTGAGGATTGAGGG + Intronic
1044155211 8:88838032-88838054 CTGTGTATGTCTATGTTTTGGGG + Intergenic
1044282998 8:90377805-90377827 CTTTGTCTGTTGATCTTTGTTGG - Intergenic
1044595778 8:93956896-93956918 TTGGCTATGTTTATGTTTGATGG - Intergenic
1044630189 8:94270951-94270973 CCGTGTAAGTTGAGGTTTAAAGG - Intergenic
1045331394 8:101158643-101158665 CTGTGTATGCAGATGATGGATGG + Intergenic
1045352208 8:101352262-101352284 CTGTGCATTTTGATATCTGAAGG + Intergenic
1046830943 8:118745248-118745270 CTATGTTTGTTGAAGGTTGAGGG + Intergenic
1048087855 8:131203347-131203369 CTGTGAATTTTGATATGTGAGGG - Intergenic
1049296354 8:141842102-141842124 CTATGGGTGTTCATGTTTGATGG + Intergenic
1049525577 8:143125050-143125072 GTGTGTGTGTACATGTTTGAGGG - Intergenic
1050605982 9:7301540-7301562 CTGTGCATTTTGGTGTCTGAGGG + Intergenic
1052106589 9:24524803-24524825 TTGTGTATTTTGATCTTTGTTGG + Intergenic
1053172967 9:35904205-35904227 GTGTGTATGTGTATGTGTGAGGG + Intergenic
1053634936 9:39988317-39988339 CTGTTTCTGTTGAGATTTGATGG + Intergenic
1053770989 9:41475991-41476013 CTGTTTCTGTTGAGATTTGATGG - Intergenic
1054208951 9:62262380-62262402 CTGTTTCTGTTGAGATTTGATGG - Intergenic
1054315864 9:63585760-63585782 CTGTTTCTGTTGAGATTTGATGG + Intergenic
1054549725 9:66387821-66387843 CTGTTTCTGTTGAGATTTGATGG - Intergenic
1054788428 9:69232051-69232073 CTCTGTAAGTTGTTGTTAGATGG + Intronic
1054934191 9:70669213-70669235 AGGTGTCTGCTGATGTTTGAAGG - Intronic
1055185977 9:73454672-73454694 GTGTGTATGTGTATGTTTCAGGG + Intergenic
1055488842 9:76783842-76783864 CTGTGTGTGTGGATATTTAAAGG - Intronic
1055917107 9:81415760-81415782 CTGTGTATGTGTATGTTTAATGG - Intergenic
1058022906 9:100108959-100108981 CTATGTATGTTTATATTTTAAGG - Intronic
1060009022 9:120027102-120027124 CTGTGTCTGCTGTAGTTTGATGG - Intergenic
1060081875 9:120656183-120656205 CTGAGAATTTTGATGTTTAAAGG - Intronic
1060116440 9:120945068-120945090 GTGTGTGTGTTGGTGTTGGAAGG - Intergenic
1060227843 9:121806669-121806691 GTGTATATGTGGATGTGTGAGGG + Intergenic
1061105514 9:128527244-128527266 CAGTGTGTGTTGACCTTTGAGGG + Exonic
1061528583 9:131191059-131191081 CTGTGTTTGTTTATTTTAGAAGG + Intronic
1186076799 X:5888677-5888699 GTGTGTATATTTATGTTTAACGG + Intronic
1189101394 X:38193726-38193748 ATCTGTAATTTGATGTTTGAAGG - Intronic
1190795906 X:53741637-53741659 CTGTGGATGTTCTTGTTTAAAGG - Intergenic
1191002938 X:55680832-55680854 TTGTCTCTGTTGATCTTTGATGG + Intergenic
1191127739 X:56975507-56975529 GTGTTTATGTTAATGTTGGAGGG + Intergenic
1195543670 X:106090982-106091004 CTGTGTATTTTACTGTTTGGGGG - Intergenic
1195776691 X:108414025-108414047 CAGTGTATGATGATTTTTAATGG + Intronic
1196972462 X:121124474-121124496 CTGTGTTTGTTGATGTTTCCAGG + Intergenic
1197357018 X:125447646-125447668 CTGGGTTAGTTGATTTTTGAAGG - Intergenic
1198480585 X:137036126-137036148 CTGTATAGGGAGATGTTTGAGGG + Intergenic
1200372613 X:155743007-155743029 CTGGTTTTGTTGATTTTTGAAGG - Intergenic
1201298853 Y:12488992-12489014 ATGTGTTTGTTTATGTATGAGGG - Intergenic
1201859433 Y:18579819-18579841 CTATGTATGTTTATGTTAAATGG + Intronic
1201873888 Y:18740562-18740584 CTATGTATGTTTATGTTAAATGG - Intronic
1202116210 Y:21470918-21470940 CTGTGTGTGTTGGTGTGTGTGGG + Intergenic
1202601009 Y:26592985-26593007 CTGTGCATGTTTATAGTTGAAGG - Intergenic