ID: 1137577825

View in Genome Browser
Species Human (GRCh38)
Location 16:49615257-49615279
Sequence CGGCAGGCAAATGCAAATTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137577823_1137577825 -6 Left 1137577823 16:49615240-49615262 CCAGGTAAAATACAGGACGGCAG 0: 1
1: 0
2: 2
3: 21
4: 131
Right 1137577825 16:49615257-49615279 CGGCAGGCAAATGCAAATTTCGG 0: 1
1: 0
2: 0
3: 4
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137577825 Original CRISPR CGGCAGGCAAATGCAAATTT CGG Intronic
901074921 1:6548074-6548096 GGCCACGCCAATGCAAATTTTGG - Intronic
906499874 1:46333820-46333842 AAGCAGGCTAATGCAAATTGAGG - Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
911337829 1:96602364-96602386 CAGCAGTCAATTGCAAAGTTTGG + Intergenic
917649787 1:177065043-177065065 AGGCTCGCAAAAGCAAATTTGGG + Intronic
917769879 1:178266299-178266321 CATCAGGGAAATGCAAATTAAGG - Intronic
918670289 1:187206288-187206310 CTGCAGGGAAATGTAATTTTGGG + Intergenic
919769788 1:201150120-201150142 AGGCAGACACTTGCAAATTTAGG - Intronic
921114426 1:212074602-212074624 CACTAGGCAAATTCAAATTTAGG - Intronic
922065931 1:222143233-222143255 AGACAGGCAAAAGCAAATGTTGG + Intergenic
1065493095 10:26302531-26302553 CAGACTGCAAATGCAAATTTAGG + Exonic
1066642033 10:37563735-37563757 GGGCAGAAAAATGTAAATTTAGG + Intergenic
1073471996 10:103728152-103728174 CTGCAGGCAGATGCAGGTTTGGG + Intronic
1074697881 10:116067010-116067032 CAGCTGGCATATGCAAATATAGG - Intronic
1078940566 11:16000425-16000447 AGGTAGGCAAATGCAAAATATGG + Intronic
1080268046 11:30422210-30422232 AAGCAGGCAAATGCAAAGGTGGG + Intronic
1083506917 11:63166662-63166684 AGGGTGGCAAATGGAAATTTTGG - Intronic
1091521314 12:1246798-1246820 TGCCAGACAAATGCAAATTCTGG + Intronic
1095149958 12:38781843-38781865 CATCACACAAATGCAAATTTAGG + Intronic
1098959277 12:76721790-76721812 CTGCTGACAAATGCCAATTTGGG - Intergenic
1100343394 12:93703049-93703071 AGCCAGCCAAATGCAGATTTTGG + Intronic
1102817764 12:115881812-115881834 TGGCAGCCTGATGCAAATTTTGG - Intergenic
1103875304 12:124122544-124122566 CGGCAGACAAATCCAAATGGAGG - Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1105406470 13:20136528-20136550 GGGTAGGCAGATGAAAATTTTGG + Intergenic
1105792524 13:23816504-23816526 CTACAGTCAAATGCAAATGTAGG - Intronic
1108048451 13:46405723-46405745 AGGTGGGCTAATGCAAATTTAGG - Intronic
1108415298 13:50192343-50192365 TGGCAAGCAAATGCCAATCTTGG + Intronic
1110887825 13:80659973-80659995 CATCAGGGAAATGCAAATTAAGG - Intergenic
1112168012 13:96940716-96940738 CGCCAGGCAAATGGAAGATTTGG + Intergenic
1112488881 13:99844189-99844211 CTGCAGACAAATGCAAGATTGGG + Intronic
1113129990 13:107025113-107025135 CAGGAGTTAAATGCAAATTTAGG + Intergenic
1115301838 14:31893633-31893655 CTGCAGGCCAATGCAAATAAAGG - Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1116800988 14:49443051-49443073 AGACAGGAAAATGCATATTTTGG - Intergenic
1117157566 14:52956090-52956112 CAGCAGGGAAATACAAATTAAGG + Intergenic
1118364302 14:65081314-65081336 CTACATGCACATGCAAATTTGGG - Intronic
1118591254 14:67403074-67403096 AGACAGGCAAATACAAATTCTGG - Intronic
1119463140 14:74828880-74828902 CTGATGGCAAATGCAAAGTTGGG - Intronic
1119692617 14:76688571-76688593 CCTCAGGGAAATGCAAATTAAGG - Intergenic
1122187693 14:100013812-100013834 CGGGAGCCAAATGCCAAGTTTGG + Intronic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1125792248 15:42376023-42376045 CCGCAGACAAATGCCAATTGAGG - Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1130216861 15:81979812-81979834 CAGCAGACAAATGCAAATTAAGG - Intergenic
1137577825 16:49615257-49615279 CGGCAGGCAAATGCAAATTTCGG + Intronic
1139095723 16:63702846-63702868 CTGCAGACAAATGGAAATGTGGG + Intergenic
1140181744 16:72727143-72727165 TGGAATGCAAATGAAAATTTTGG - Intergenic
1140732345 16:77868097-77868119 CTGTAGGCTAATGTAAATTTAGG - Intronic
1144910244 17:18674653-18674675 TTACAGACAAATGCAAATTTAGG + Intronic
1145281161 17:21468030-21468052 CGGCAGTAAAATGGAAATATAGG + Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1148444901 17:47731592-47731614 TGGCAGGCAAAGGCAAAGCTGGG - Intergenic
1149503682 17:57175118-57175140 AGGCAGGCAAATGAAGAATTAGG + Intergenic
1155921631 18:31609404-31609426 CATCAGGCAAATCCAAATTGAGG - Intergenic
1158641773 18:59209688-59209710 CTGCAGGAAAATGGAAATTCAGG + Intergenic
1168643403 19:58044728-58044750 CAGCAGCCAAATGAAACTTTCGG - Intronic
932792486 2:74667887-74667909 CAGGAGGCAGATGCAGATTTGGG - Intronic
934940314 2:98496782-98496804 CATCAGGGAAATGCAAATTAAGG + Intronic
934965374 2:98717033-98717055 CATCAGGCAAATTCAAATTAAGG + Intronic
936583684 2:113731108-113731130 TGTCAGACAAATGCAAATTGAGG + Intronic
937624278 2:124025595-124025617 CGGCTGGCTACTGCGAATTTGGG + Exonic
940590034 2:155711526-155711548 CTGCAGGTAAAGGAAAATTTTGG - Intergenic
941492031 2:166154280-166154302 TGGCAGGCAAATAACAATTTCGG + Intergenic
941809986 2:169745894-169745916 CAGCAGGCAAAGGGAAATGTGGG + Intronic
942216421 2:173724312-173724334 GGCCAGGTAAATGTAAATTTTGG - Intergenic
942607422 2:177707636-177707658 CTGCAGGCTCATGCAGATTTGGG - Intronic
943406161 2:187490087-187490109 TGTCAACCAAATGCAAATTTTGG - Intronic
946657725 2:221966345-221966367 AAGGAAGCAAATGCAAATTTGGG - Intergenic
947852538 2:233299905-233299927 CGGCAGGCAAATTCTGACTTTGG + Intergenic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1178482543 21:32991953-32991975 CTGGAGTCAAATGCAAATCTGGG + Intergenic
1182763861 22:32744583-32744605 AGACGGTCAAATGCAAATTTGGG + Intronic
1183794724 22:40106784-40106806 CTGATGGCAAATGCCAATTTGGG + Intronic
950229068 3:11260146-11260168 CACCAGGCAAAGGCAAATTGAGG + Exonic
950236880 3:11330024-11330046 CATCAGACAAATGCAAATTAAGG - Intronic
954920355 3:54185455-54185477 CTGCAGACAAATTAAAATTTTGG - Intronic
955372212 3:58362054-58362076 CCTCAGGGAAATGCAAATTAAGG - Intronic
956894373 3:73644827-73644849 TGGAAAGCACATGCAAATTTTGG - Intergenic
959400482 3:105895590-105895612 CAGAAGGAAAATGTAAATTTTGG - Intergenic
960535862 3:118813689-118813711 GGGCAGGCAAATGGAAATGGGGG - Intergenic
963830943 3:150008274-150008296 CAGCAGGGAAAAGCAAATTAGGG + Intronic
964104826 3:153027790-153027812 AGGCAAGTAAATGAAAATTTGGG - Intergenic
965140556 3:164828335-164828357 CGCCAGCTAAATTCAAATTTGGG - Intergenic
965672773 3:171163814-171163836 AAGCAGTCAAAAGCAAATTTTGG - Intronic
966542230 3:181105151-181105173 CAGTAGGCAAAGGCAAATATGGG - Intergenic
970522943 4:16903735-16903757 AGGCAGGTAAATGGAAATTAGGG - Intergenic
973285443 4:48410867-48410889 CTGCTGGCAACTGCACATTTTGG - Intronic
973775535 4:54238061-54238083 CAGCATGCACATGCAAACTTTGG + Intronic
973777293 4:54255206-54255228 CAGCATGCACATGCAAACTTTGG + Intronic
978870495 4:113571062-113571084 CATCAGGAAAATGCAAATTAAGG + Intronic
979505335 4:121488792-121488814 AAGCAGACAAAAGCAAATTTGGG + Intergenic
981020041 4:140017217-140017239 CACCAGGGAAATGCAAATTAAGG + Intronic
981744378 4:148038045-148038067 GGGTAGGAAAATACAAATTTTGG + Intronic
983308457 4:166024122-166024144 AGGCAGACAAAAGCAACTTTGGG - Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
986406014 5:7425716-7425738 CGGCAGGCAAATGCCTTTATTGG - Intronic
987060643 5:14240044-14240066 AGTCAGGCAAAAGCTAATTTAGG - Intronic
989311324 5:40022121-40022143 AGGCATGTCAATGCAAATTTAGG + Intergenic
989846548 5:46151439-46151461 CGACCTGCAAATGGAAATTTGGG + Intergenic
990781398 5:59368602-59368624 CAGCAGGAAAAACCAAATTTTGG + Intronic
993162249 5:84307249-84307271 CTGCAGGCTAATGAAAATTGGGG + Intronic
1002214549 5:177620781-177620803 CAGGAAGCAAATACAAATTTTGG + Intergenic
1003571460 6:7259043-7259065 CGGCAGGCAGATGAGAATCTAGG + Intergenic
1003768475 6:9268707-9268729 CACCAGGCATATGCAAATGTTGG - Intergenic
1007489500 6:42207821-42207843 AGGCTGGCATATGCTAATTTGGG - Exonic
1008627545 6:53332726-53332748 TGGTAGGCAAATGGAAAGTTTGG - Intronic
1008752374 6:54751211-54751233 CGGCAGGCAATTGACAATGTTGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1011887129 6:92109911-92109933 CAACAGGGAAATGCAAAGTTGGG - Intergenic
1014797657 6:125745725-125745747 CTGAAAGCAAGTGCAAATTTAGG - Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1017123559 6:151045767-151045789 GGCCAGGGAAATGCATATTTGGG - Intronic
1021486335 7:21172561-21172583 AGGGAGGCAAATGGAAATATGGG - Intergenic
1022563237 7:31371820-31371842 CAGAAGGCAAATACACATTTGGG - Intergenic
1024331362 7:48158887-48158909 AGGCACCCAAATGCAAGTTTAGG + Intergenic
1024356483 7:48418410-48418432 CATCAGGAAAATGCAAATTAAGG - Intronic
1024558020 7:50620487-50620509 CGGCATGCAGAAGCAAATTCTGG + Intronic
1026076809 7:67179167-67179189 GGGCAGGCCAATGCAAATAAAGG + Intronic
1026700053 7:72633172-72633194 GGGCAGGCCAATGCAAATAAAGG - Intronic
1029052484 7:97703425-97703447 AGGCTGGCATATGCCAATTTGGG + Intergenic
1030384809 7:108855761-108855783 CACCAGACAAATGCAAATTGAGG - Intergenic
1030431887 7:109458483-109458505 CTACAGACAAAGGCAAATTTAGG + Intergenic
1036474920 8:9084495-9084517 AGGCTGGAAAATGCAAATTTGGG - Intronic
1037910567 8:22741438-22741460 CAGCAGGCAAATGCCAATCCGGG + Intronic
1038405325 8:27318217-27318239 CTGCAGGCAAATGCATTGTTAGG - Intronic
1038740999 8:30216732-30216754 CAGCAGACAAATTCAAATTGAGG + Intergenic
1043128764 8:76434237-76434259 GAACAGGCAAATACAAATTTTGG + Intergenic
1043524978 8:81086742-81086764 AGCCAGGGAAATGCAAATTGAGG + Intronic
1044294036 8:90506520-90506542 GGACAGGCAAATGCTTATTTGGG + Intergenic
1048471219 8:134705936-134705958 CATCAGGGAAATGCAAATTAAGG + Intronic
1053052308 9:34971966-34971988 CGGGAGGCAATTGGAAATTTGGG + Intronic
1053402358 9:37836854-37836876 AGGCTGGCATATGCTAATTTGGG + Intronic
1053684911 9:40511881-40511903 GGCCAGGGAAATGCATATTTGGG - Intergenic
1053934871 9:43140164-43140186 GGCCAGGGAAATGCATATTTGGG - Intergenic
1054278816 9:63113075-63113097 GGCCAGGGAAATGCATATTTGGG + Intergenic
1054298002 9:63347344-63347366 GGCCAGGGAAATGCATATTTGGG - Intergenic
1054396020 9:64651862-64651884 GGCCAGGGAAATGCATATTTGGG - Intergenic
1054430663 9:65157057-65157079 GGCCAGGGAAATGCATATTTGGG - Intergenic
1054499716 9:65864464-65864486 GGCCAGGGAAATGCATATTTGGG + Intergenic
1055229012 9:74038966-74038988 CATCAGGCAAATCCAAATTAGGG + Intergenic
1058333294 9:103792299-103792321 AGTCAGGGAAATGCAAATTAAGG - Intergenic
1062256820 9:135627910-135627932 CTTCAGGGAAATGCAAATTAAGG - Intronic
1186322948 X:8450334-8450356 CAGCAGGTAAATTCAAATTCAGG + Intergenic
1189138326 X:38573786-38573808 CATCAGGCAAATCCAAATTGAGG - Intronic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1195692092 X:107635371-107635393 CTCCAGGGAAATGCATATTTTGG + Intronic