ID: 1137577879

View in Genome Browser
Species Human (GRCh38)
Location 16:49615591-49615613
Sequence GCCTGAAGTCCCCCAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137577875_1137577879 13 Left 1137577875 16:49615555-49615577 CCATGGTGGGGGCAGAGGGCAGT 0: 1
1: 0
2: 2
3: 44
4: 472
Right 1137577879 16:49615591-49615613 GCCTGAAGTCCCCCAGCTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 275
1137577874_1137577879 14 Left 1137577874 16:49615554-49615576 CCCATGGTGGGGGCAGAGGGCAG 0: 1
1: 0
2: 8
3: 50
4: 427
Right 1137577879 16:49615591-49615613 GCCTGAAGTCCCCCAGCTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137577879 Original CRISPR GCCTGAAGTCCCCCAGCTGC TGG Intronic
900110947 1:1005364-1005386 GGCTGCTGTCCCTCAGCTGCCGG + Intergenic
900115011 1:1024636-1024658 GCCTGAGGTGCACCTGCTGCTGG + Intronic
900311988 1:2037972-2037994 GCCTGAAGTCACCCAGTTTGTGG + Intergenic
900614318 1:3557729-3557751 CCCTGAACTCCCCCTGCTGCTGG - Intronic
900694446 1:4001136-4001158 GCTTGAAGACCTCCAGCTGCTGG + Intergenic
901068912 1:6507687-6507709 GCCTGCACGCCCCCAGCTGAGGG + Intronic
901080527 1:6581263-6581285 GGCTGAAGGTGCCCAGCTGCAGG + Exonic
903264992 1:22152832-22152854 TCCTGGAGGCCCCAAGCTGCGGG - Intergenic
903646333 1:24898321-24898343 GCCTGAGGTCCCAGGGCTGCGGG - Intergenic
904171390 1:28594000-28594022 GCTTGATGTCCCCCTGCTGCAGG - Exonic
904498564 1:30901254-30901276 GCCTGACATCCCACAGCTGATGG - Intronic
904614572 1:31742947-31742969 GCCTGTGCTCCCGCAGCTGCGGG - Exonic
906132352 1:43468264-43468286 TCCTGAAGTCTCCAAGCTTCCGG - Intergenic
907630556 1:56077080-56077102 GACTTAACTTCCCCAGCTGCAGG - Intergenic
908104745 1:60829905-60829927 TCTGGAAGTCCCTCAGCTGCTGG + Intergenic
908178309 1:61578626-61578648 GAGTCAAGTCCCTCAGCTGCAGG + Intergenic
908506351 1:64805012-64805034 GTCTGAAGTACCACAGCTGGGGG - Exonic
912132448 1:106619586-106619608 GCCTGAATTCTCCCTGCTGTTGG + Intergenic
912798123 1:112705108-112705130 GGCTGAAGTTCCCAGGCTGCAGG + Exonic
915274100 1:154776173-154776195 GCCTGAAGTCCCCCACATCCAGG + Intronic
915512244 1:156392696-156392718 GCCAGGAGTGCCCCAGCTGGGGG + Intergenic
916856735 1:168757824-168757846 GCATGCTTTCCCCCAGCTGCTGG + Intergenic
917513062 1:175683984-175684006 GGCTGGAGTCTCCCAGCTCCCGG - Intronic
918968146 1:191378034-191378056 GAGTGAAGTCCCTCAGCTGCAGG + Intergenic
919704080 1:200659768-200659790 GCCTCAACTTCCCCAGCTCCAGG + Intronic
919801865 1:201359137-201359159 GCCTGCACTCCCCCAGTTCCCGG - Exonic
922473279 1:225889445-225889467 GGCTCAGTTCCCCCAGCTGCTGG + Intronic
922604659 1:226882059-226882081 GTTTGAAGGCCCCCAGCTGCTGG - Intronic
922764557 1:228150325-228150347 ACCTGAGGGGCCCCAGCTGCTGG - Intronic
924013295 1:239691107-239691129 TCCTGGATTCCCCCAGCAGCAGG - Intronic
924816735 1:247448545-247448567 ACCTGAGGGCCCCCAGCTGGAGG - Exonic
1065176340 10:23079845-23079867 CCCTGAGGTTGCCCAGCTGCTGG + Intergenic
1065820113 10:29517527-29517549 GGCTGAAATCTCCCAGCTACAGG + Intronic
1067015581 10:42754775-42754797 CCCTGTGGTCCCCCAGCCGCCGG + Intergenic
1067812585 10:49441603-49441625 GCGTGCTGTCCCCCAGCCGCCGG + Intergenic
1068283857 10:54909976-54909998 GCCTGAAAGCACCCAGCTGAAGG - Intronic
1068443814 10:57095111-57095133 GCCTGGCCTCCCCCTGCTGCAGG + Intergenic
1070724593 10:78779461-78779483 GCCTGAGGTCACCCAGCTACAGG + Intergenic
1070754241 10:78981822-78981844 GCCAGGAGTCCCCCAGCCCCAGG + Intergenic
1070835511 10:79445011-79445033 GCCCGAAGTCCCCGGGGTGCCGG - Intronic
1070981911 10:80655187-80655209 GCCTGCAGGGCCCCAGGTGCAGG + Intergenic
1072625244 10:97107182-97107204 GAGGGAAGTACCCCAGCTGCAGG + Intronic
1077159183 11:1104934-1104956 GCCTGCAGGCCCCCAGCTCCAGG - Intergenic
1077274138 11:1695588-1695610 GCCTGGAGTCATCCAGCTCCAGG + Intergenic
1078748488 11:14137860-14137882 GCCTCAGGTTCCCCAGCTCCTGG + Intronic
1079874415 11:25838824-25838846 GCCAGCAGTCCCCCACCTTCTGG + Intergenic
1080393179 11:31866634-31866656 GCCCAAAGTCACCCAGCTGATGG + Intronic
1080807492 11:35667630-35667652 GCCTGTAATCCCACAGCTGTAGG - Intronic
1080977989 11:37365034-37365056 TCCTCAAGTCTCCCAGCAGCAGG - Intergenic
1081981596 11:47270193-47270215 GCCCGACGTCCCCCGGCAGCGGG - Intronic
1082104810 11:48210232-48210254 GCCTAAAGTCCCCCTGCTGGCGG + Intergenic
1083433286 11:62626070-62626092 GTCTGGAGTACCACAGCTGCTGG + Exonic
1083844057 11:65320991-65321013 GGCGGAAGTCCCCCAGCGGTGGG - Exonic
1084067668 11:66714647-66714669 GCCTGCAGTTCCCCACCTGGAGG - Intronic
1084183126 11:67456354-67456376 GCATGCAGTCACCCAGCTCCCGG - Exonic
1084493557 11:69491028-69491050 GCCTGCTGTGCGCCAGCTGCTGG + Intergenic
1084646285 11:70460488-70460510 CCCTGATGTCCCACAGCTGGAGG + Intergenic
1085441432 11:76567112-76567134 TCCTGCAGTCCCACAGCTGCTGG - Intergenic
1087046769 11:93849844-93849866 GCCTGAAGTCCCCAGGCTGGAGG - Intronic
1089696627 11:120219871-120219893 GCCTGCAGGAGCCCAGCTGCAGG + Intronic
1091704816 12:2686516-2686538 TCCTGAGGACCCACAGCTGCAGG + Intronic
1091929773 12:4386006-4386028 CCTTGATGTCCCCCCGCTGCTGG - Intergenic
1092230679 12:6773868-6773890 GCGAGAAGTCCCCGCGCTGCCGG - Exonic
1093065817 12:14657030-14657052 GCCTGAGCTCCCCCTGCTGTCGG - Intronic
1093460455 12:19402942-19402964 TCCTCAAGTCTCCCAGCAGCAGG + Intergenic
1096503856 12:52080964-52080986 TCCCGAGGCCCCCCAGCTGCGGG - Intergenic
1096510830 12:52127263-52127285 GTCTGTAGTCTCCCAGCAGCCGG + Intergenic
1096554236 12:52393538-52393560 GCCTGGATACCCCCAGCTCCAGG - Intergenic
1096646929 12:53043898-53043920 CCGAGAAGCCCCCCAGCTGCAGG + Intergenic
1096871713 12:54596711-54596733 GCCACATGTCCCCCAGGTGCTGG + Intergenic
1097372112 12:58796930-58796952 GCCTGAAGTCCCCCAAACCCTGG - Intronic
1097912085 12:64981613-64981635 CCCTCAGGTCCCTCAGCTGCAGG + Intergenic
1098520572 12:71431382-71431404 TCCTCAAGTCTTCCAGCTGCAGG - Intronic
1101059282 12:100954293-100954315 GCCTGAAGCACCACAGCAGCAGG + Intronic
1102029316 12:109730862-109730884 GCCTGCAGTCACACAGCAGCGGG - Intronic
1102254380 12:111407214-111407236 CCCTGGAGGCCCCCAGCTGCAGG - Intronic
1102335410 12:112074681-112074703 GCCTGGAGTCCTCCTGCTGAAGG - Exonic
1102938409 12:116916646-116916668 GCCTCAACTCCCCCAGCAGCTGG - Intronic
1103024382 12:117561917-117561939 GCCTGGAGTGCCCCAGATACTGG + Intronic
1104584712 12:130038679-130038701 ACCTGGAGGCCCTCAGCTGCTGG - Intergenic
1109001561 13:56811772-56811794 TCCTCAAGTCTCCCAGCTGAGGG - Intergenic
1110202261 13:72866048-72866070 GCCTGGAGGCCCCCAGAAGCTGG - Intronic
1112680083 13:101754165-101754187 CCCTGAAGCTCCTCAGCTGCTGG + Intronic
1113847497 13:113401147-113401169 CCCTGAGCTCCCCCAGCTCCAGG + Intergenic
1113928665 13:113954765-113954787 GGCTGGAGTCCTCCAGCTGGTGG + Intergenic
1114535397 14:23419200-23419222 TCTTGAGGTCCTCCAGCTGCTGG + Exonic
1114618541 14:24081490-24081512 GCCCGCAGCCCCGCAGCTGCCGG + Exonic
1117875796 14:60249305-60249327 GCCTGAGGACCCGAAGCTGCGGG - Intronic
1118132037 14:62977250-62977272 GCCTCAACTTCCCCAGCAGCTGG - Intronic
1119477080 14:74936673-74936695 TTCTGATGTTCCCCAGCTGCAGG + Intergenic
1120935565 14:89892327-89892349 GCTTGATGTCCCCCTGCTGCAGG - Intronic
1121044512 14:90778122-90778144 GCCTGGAGCCCCCAGGCTGCTGG + Intronic
1122304430 14:100753048-100753070 GCATTAATTTCCCCAGCTGCTGG - Intergenic
1122463217 14:101913029-101913051 GCCGGACGTCCCGGAGCTGCCGG + Intronic
1122826893 14:104374924-104374946 GCCTGAGGTCACACAGCTGCTGG - Intergenic
1123018282 14:105385835-105385857 CCCTGAGGGCCACCAGCTGCAGG + Intronic
1123499560 15:20867307-20867329 GCCAGAAGCCCCACAGCTGTTGG - Intergenic
1123556812 15:21441037-21441059 GCCAGAAGCCCCACAGCTGTTGG - Intergenic
1123593035 15:21878273-21878295 GCCAGAAGCCCCACAGCTGTTGG - Intergenic
1124244897 15:28060269-28060291 GCCTGCAGTGCCCCAGCTAGAGG - Intronic
1128699807 15:69795979-69796001 GCAAGATGTCCCCTAGCTGCTGG + Intergenic
1130549966 15:84884208-84884230 ACCTGAGGTCCTCCAGCTGTTGG + Intergenic
1202965155 15_KI270727v1_random:168226-168248 GCCAGAAGCCCCACAGCTGTTGG - Intergenic
1132559559 16:587218-587240 GCCTGAGATCTCTCAGCTGCAGG + Intergenic
1132651213 16:1022185-1022207 ACCAGACGGCCCCCAGCTGCAGG - Intergenic
1132767381 16:1541377-1541399 GTCCCAAGTCCCTCAGCTGCTGG + Intronic
1134071184 16:11260787-11260809 GCCTGAAGCCACACAGCTGATGG - Intronic
1134630400 16:15752150-15752172 GCCTGTAGTCCCTCCTCTGCGGG - Intronic
1135396119 16:22132850-22132872 GCTTCAAGGCCCTCAGCTGCTGG + Intronic
1135629449 16:24024299-24024321 TCCTGCTGTCCCCCAGCTTCTGG - Intronic
1136621150 16:31429252-31429274 CCCCTAGGTCCCCCAGCTGCAGG + Intergenic
1137407977 16:48205185-48205207 GCCCGAAGTCACCCAGGTGGTGG - Intronic
1137577879 16:49615591-49615613 GCCTGAAGTCCCCCAGCTGCTGG + Intronic
1137735785 16:50722127-50722149 GCTTCAACTCCCCCAGCTTCTGG - Intronic
1138464702 16:57180793-57180815 GCCTGCAGTCCCAAAGCTGTGGG + Intronic
1139041612 16:63005271-63005293 TCCTCAAGTCTCCCAGCAGCGGG + Intergenic
1140083368 16:71772250-71772272 GCCTGTAGTCCCTCACCTGGAGG - Intronic
1141365675 16:83440518-83440540 GCCTGTAGTCCCAGAGCTTCAGG + Intronic
1141628303 16:85273145-85273167 GCCTGGGGTCCCCCACCTGTAGG - Intergenic
1143303072 17:5925245-5925267 GCCTGGAGTCCCGCAGGTGCTGG + Intronic
1143987957 17:10931428-10931450 TCCTGGAGTCTTCCAGCTGCTGG + Intergenic
1144640771 17:16935399-16935421 GCATGAGGTCACCCAGCAGCCGG + Intronic
1144826719 17:18109281-18109303 GCCTGAGGACCCCCAGCCTCTGG - Intronic
1145058575 17:19718443-19718465 GCCTGATGTCACCGAGCTGATGG - Intronic
1145965312 17:28912787-28912809 TTCTGAAGGCCCCCAGCCGCTGG + Exonic
1146043677 17:29483335-29483357 GCTTGAAATCCCCCCACTGCGGG - Intronic
1148792321 17:50180314-50180336 TCCTGAAGTCCCCCAGCCAGTGG - Intergenic
1148837126 17:50471247-50471269 GCCTAGAGCCCCCCAGCAGCAGG + Intronic
1151626250 17:75277708-75277730 GGCCGCAGTCCCCCAGCTGGAGG + Intronic
1152112186 17:78363018-78363040 GCCTAAAGTCACACAGCTACTGG - Intergenic
1152933451 17:83122337-83122359 GCTTCGGGTCCCCCAGCTGCAGG + Intergenic
1154343998 18:13527551-13527573 GCCTGCAGTCCCTCACCCGCGGG + Intronic
1154457619 18:14544182-14544204 GCCAGAAGCCCCACAGCTGTTGG - Intergenic
1155341321 18:24817389-24817411 GCCTGAGGTGACCCAGCTGGAGG + Intergenic
1157098755 18:44711082-44711104 GCTTGCACTCCCCCAGCAGCGGG - Intronic
1157107488 18:44788252-44788274 TCCTGAACTCCTCCAGCAGCAGG + Intronic
1157674989 18:49562185-49562207 GCCTCCAGTCCCCCAGCCCCTGG + Exonic
1157685770 18:49641115-49641137 AACTGAAGGCCCCCAGCTTCAGG + Intergenic
1158648713 18:59268747-59268769 GCCTGTTGCCCTCCAGCTGCAGG + Exonic
1158888503 18:61851421-61851443 GCCTGAGCTGCCCCAGCTTCAGG + Intronic
1159055081 18:63455259-63455281 GCCAGTAGTGCACCAGCTGCAGG - Intergenic
1161450752 19:4344051-4344073 GCCTGGAGTTCCCTTGCTGCAGG + Intronic
1161590789 19:5128284-5128306 GCCTCACGGCCTCCAGCTGCAGG - Intronic
1162559343 19:11406769-11406791 GCCTCAAGGTCCCCAGCTCCTGG - Exonic
1162589847 19:11584311-11584333 GCATGATGTCCCCCAGCTGTGGG + Intronic
1163255109 19:16151512-16151534 GCCTGAGGTCACACAGCTGATGG + Intronic
1163312057 19:16520670-16520692 GCCTGAATTCACACAGCAGCAGG - Exonic
1163520255 19:17787859-17787881 TCCTGAGGTCACCCAGCAGCAGG - Intronic
1163826468 19:19527388-19527410 GCCGGAAGGCCCCAGGCTGCAGG + Intronic
1165323141 19:35098729-35098751 TCCTGTGATCCCCCAGCTGCCGG + Intergenic
1165446329 19:35858708-35858730 CCCAGAAGCCCCCCAGGTGCTGG + Exonic
1165821609 19:38680025-38680047 GCCTTAAGTACCCCATCTGTGGG + Intronic
1166000437 19:39874397-39874419 GCCTGAGGGCACCCAGCTGTGGG + Intronic
1166003229 19:39890638-39890660 GCCTGAGGGCACCCAGCTGTGGG + Intronic
1166130390 19:40742540-40742562 GCGAGAAGTCCGTCAGCTGCAGG + Exonic
1166296522 19:41892688-41892710 AACGGAAGTCCTCCAGCTGCCGG - Exonic
1167102968 19:47415415-47415437 GCCTGTTGGCCCCCAGCTCCAGG + Intronic
1167341333 19:48918309-48918331 GCCTGAAGCCCTGCAGCTGTGGG + Intronic
1167457040 19:49601747-49601769 TCCCGAAGACCCCGAGCTGCCGG + Exonic
1168289477 19:55350546-55350568 GCTTGGCGTCCCTCAGCTGCAGG + Exonic
1168382038 19:55932176-55932198 ACCAGAAGTCCATCAGCTGCTGG + Exonic
925154373 2:1638623-1638645 GCCTGGTGACCCCCATCTGCTGG + Intronic
925338591 2:3116632-3116654 GCGTGAAGGCTCCCAGCTGGGGG + Intergenic
925351463 2:3203843-3203865 GCCTGGATTCCTCCAGCTGTTGG - Intronic
929078357 2:38096929-38096951 CCCTGAAGTCACCCAACTCCTGG - Intronic
929935659 2:46292794-46292816 GCCTGGACTGGCCCAGCTGCCGG - Intergenic
930063654 2:47311140-47311162 GCCTGAGGCCCCCCACCTCCTGG - Intergenic
931467731 2:62506084-62506106 GGCTGAAGTTTCCCAGCCGCTGG + Exonic
934573076 2:95384346-95384368 GTCTGCAGGCCACCAGCTGCTGG + Exonic
936709205 2:115111670-115111692 GCTTGCCTTCCCCCAGCTGCTGG - Intronic
936950860 2:117976001-117976023 GCCTGAGGTCACCCAGCTGGTGG - Intronic
937086783 2:119177198-119177220 GCCCAAGGTCCCCCAGCTGGTGG - Intergenic
937907205 2:127058151-127058173 GCCTGAGGTCCCCCACCTGGTGG - Intronic
938181825 2:129191179-129191201 GCCTGAGGTCACCCATCTACGGG + Intergenic
938473934 2:131590538-131590560 GCCAGAAGCCCCACAGCTGTTGG + Intergenic
940706271 2:157108343-157108365 TCCTCAAGTCTCCCAGCAGCAGG - Intergenic
940998880 2:160180388-160180410 GCCTGTAGTCCCAGAGCTGGAGG - Intronic
941873711 2:170411965-170411987 GTCTGAAGTGGCCCATCTGCAGG - Intronic
948447345 2:238043116-238043138 CCCTGGAGTTCCCCAGCTGGTGG + Intronic
948485562 2:238278778-238278800 GCCTGGGATCCCCGAGCTGCTGG - Intronic
1170802063 20:19598670-19598692 GCCTTGAGTCCCCCAGCTGCTGG - Intronic
1171457138 20:25278494-25278516 GCCTGAAGGCGCCCAGCCCCTGG - Intronic
1172214460 20:33225287-33225309 TCCTGATGAGCCCCAGCTGCAGG + Intronic
1172748650 20:37233621-37233643 GCGTGAATGCCACCAGCTGCCGG + Intronic
1172776342 20:37409382-37409404 GCCAGAGGTCCCCCTGCTGACGG - Intergenic
1173679603 20:44868585-44868607 GCATTTATTCCCCCAGCTGCTGG - Intergenic
1174112490 20:48206002-48206024 GCCTGAGGCCCAACAGCTGCTGG - Intergenic
1175249133 20:57598261-57598283 AGCTGAATGCCCCCAGCTGCTGG - Intergenic
1176101684 20:63367374-63367396 GCCTGAGGTCCCCTGGCAGCAGG - Intronic
1176512951 21:7762327-7762349 GCCTAAGGTCCCCCAGCTGGTGG + Intronic
1176816538 21:13609156-13609178 GCCAGAAGCCCCACAGCTGTTGG + Intergenic
1178647064 21:34392851-34392873 GCCTAAGGTCCCCCAGCTGGTGG + Intronic
1179356724 21:40666707-40666729 ACCTGAAGTAGCCCAGGTGCAGG - Intronic
1179402367 21:41096067-41096089 GCCTGGAGTTCCCCAGCAGCTGG + Intergenic
1179808223 21:43853529-43853551 GCCTGAGGTCACACAGCTGCAGG - Intergenic
1179935665 21:44602216-44602238 GCCTGATGCCCCCCACCCGCGGG + Intronic
1180697041 22:17758166-17758188 AGCTTAAGTTCCCCAGCTGCTGG + Intronic
1181550783 22:23638103-23638125 GCCTGGAGTCCCTCTGCTTCTGG - Intergenic
1181629585 22:24143581-24143603 GCCTGCAGTGCCACAGCAGCTGG + Intronic
1181634911 22:24170017-24170039 GCCTGGCGTCGCCCAGCAGCAGG - Intronic
1181957366 22:26597734-26597756 TCCTGATGTACCCCAGCTCCAGG + Intergenic
1182087725 22:27573220-27573242 ACCTGAAGTCGGGCAGCTGCAGG + Intergenic
1183485674 22:38086511-38086533 GCCTAAGGTGCCCCAGCTACTGG - Intronic
1184401981 22:44279731-44279753 GCCTGAAGTCCCCAGGGTCCAGG + Intronic
1184648287 22:45907944-45907966 GCCTGAGGGTCCCCAGCAGCTGG - Intergenic
1185015379 22:48339646-48339668 GCCTGAAGACCCCCAGCTCAGGG - Intergenic
949739471 3:7213833-7213855 GCCCTAACTCTCCCAGCTGCTGG - Intronic
950078775 3:10206354-10206376 AGCTGGAGACCCCCAGCTGCTGG - Intronic
951039976 3:17979353-17979375 GCCCAAAGTCACACAGCTGCTGG + Intronic
952042887 3:29281398-29281420 GCCTGGCTTCCCCCAGCTGCCGG - Exonic
952232722 3:31448292-31448314 GACATAAGTCCCCCAGCTGCTGG + Intergenic
953278129 3:41524609-41524631 GCCTGAAGTCAGCCAGAGGCAGG + Intronic
953375006 3:42421099-42421121 GCCTGAATCCCCCAAACTGCAGG - Intergenic
953565513 3:44028717-44028739 TGCTGAAGACACCCAGCTGCTGG + Intergenic
954673920 3:52305273-52305295 ACATGAGGTCCCCCAGCTGTAGG - Intergenic
955055611 3:55453069-55453091 GCTTCATTTCCCCCAGCTGCTGG + Intergenic
956054001 3:65279305-65279327 CTCTCAATTCCCCCAGCTGCTGG + Intergenic
956318685 3:67969672-67969694 GCCTAATGTCCCCCAGTTGAGGG - Intergenic
956416430 3:69035100-69035122 GCCTAAGGTCCCCCACCTGTAGG + Exonic
958903927 3:99921397-99921419 GCCTGCAGTCTCCCAGCAGAAGG + Intronic
959574840 3:107923715-107923737 GCCCGAAGTCATCCAGCTTCTGG - Intergenic
960702635 3:120451927-120451949 GCCTCACTTCCCCCAGCTTCAGG + Intergenic
960782107 3:121330945-121330967 TCCTCAAGTCTCCCAGCAGCAGG - Intronic
962366683 3:134791243-134791265 GCCTGAGAGCCCTCAGCTGCTGG + Intronic
966888279 3:184388603-184388625 GCATGGGGTCCCCCAGCTGGGGG - Exonic
967434799 3:189431497-189431519 TCCTCAAGTCTCCCAGCAGCAGG - Intergenic
967977216 3:195042208-195042230 GAATCCAGTCCCCCAGCTGCTGG - Intergenic
968606417 4:1537798-1537820 ACCTGGACTCTCCCAGCTGCTGG - Intergenic
968838240 4:2981101-2981123 TCCTGAAGTCTCCAAGCTTCTGG - Intronic
969115672 4:4869333-4869355 TCCTGAGGTCCCACAGCAGCGGG - Intergenic
969349240 4:6588762-6588784 GCTTGAATGCCCCCAGGTGCAGG - Intronic
969578525 4:8050483-8050505 TCCTGGAGTCCCCCAGGAGCTGG + Intronic
969587682 4:8104038-8104060 GCATGAAATCCACTAGCTGCAGG + Intronic
972980464 4:44694090-44694112 GTCCGAAGCCTCCCAGCTGCTGG + Intronic
973764759 4:54152972-54152994 TCCTGAACTCTCCCAGCTTCCGG - Intronic
973817430 4:54631813-54631835 GCATGCATTCCCCCAGCTGCTGG - Intergenic
978627856 4:110707740-110707762 GGCTGAAGTCAGCCAGATGCAGG - Intergenic
980582588 4:134773516-134773538 GCCTGAACTCTCCCTGCTCCTGG + Intergenic
981828479 4:148972776-148972798 GACTGAAGTCACTCAACTGCTGG + Intergenic
982106813 4:152018385-152018407 GCCTGAAGGCACCCAGGAGCAGG - Intergenic
985675210 5:1227336-1227358 CCCTGAAGTCCCCGCGCAGCTGG - Intronic
985891521 5:2719377-2719399 GCCTCAAGCCCTCCAGCTTCTGG + Intergenic
986041104 5:3994957-3994979 TCATGAACTCCACCAGCTGCAGG + Intergenic
989170660 5:38468254-38468276 GCCAGAAGTCCCAGGGCTGCCGG + Intergenic
989523032 5:42423589-42423611 GCCCGCAGTCCCCCAGATCCAGG - Intergenic
989554650 5:42779326-42779348 GCCTGAAGTGTAGCAGCTGCTGG + Intronic
992789798 5:80203027-80203049 GCCTGCAGACCCACAGCAGCAGG + Exonic
994085152 5:95750350-95750372 GAATGAAGTCCACCAGCTCCAGG - Intronic
996815966 5:127572710-127572732 GCCTGAATTCCCTCACCTGGAGG - Intergenic
997654969 5:135547802-135547824 GCCTGACGCCCACCAGCAGCAGG - Intergenic
997951168 5:138243688-138243710 GCCTGAATTCACCCAGCTGATGG + Intergenic
998417528 5:141956648-141956670 GCCTGAAGTGGCCCAGCTCTTGG + Exonic
1002181365 5:177432720-177432742 CCCTGAGGTCCCCCGGCAGCTGG + Exonic
1002444218 5:179279358-179279380 GCCAAGAGTCCCCCAGATGCTGG + Intronic
1002935693 6:1670174-1670196 GGCAGAAGTCCCCGAGCTGCTGG - Intronic
1006510195 6:34517285-34517307 GGCTGCAGTCCCCCAGGTGAGGG - Intronic
1006802371 6:36767421-36767443 GCCTAGAGTCACCCAGCTGAGGG + Intronic
1009725407 6:67531135-67531157 GCCTGAAGTCCCATATGTGCAGG - Intergenic
1012197619 6:96363474-96363496 GCCTCAGGTTCCCCAGCAGCTGG - Intergenic
1015674810 6:135733838-135733860 GCCTTCAGTCCTCCAGCAGCAGG - Intergenic
1017162473 6:151378728-151378750 GCTTGAGGTCCCACAGCTTCAGG + Intronic
1018952284 6:168386998-168387020 GCCTGAGGTGGCCCAGCTGGAGG - Intergenic
1019017532 6:168890783-168890805 GCCTGCAGTGCCCCTGCTGAGGG + Intergenic
1019474592 7:1237851-1237873 GCACGCACTCCCCCAGCTGCCGG - Intergenic
1022339784 7:29457119-29457141 GCCTCACGTTCCCGAGCTGCAGG - Intronic
1024534097 7:50415845-50415867 CACTGAGGTCCCCCAGCTGCTGG + Intergenic
1026539660 7:71268903-71268925 GCCTCAAGTCTCACATCTGCTGG - Intronic
1026700009 7:72632877-72632899 GCCTGAAGTTACACAGCTGGAGG + Intronic
1026946147 7:74317563-74317585 GCCTGAAGCCCCCCGGCCGTGGG + Exonic
1029403542 7:100359598-100359620 TTCTGAAGTCCCTTAGCTGCAGG - Intronic
1029679030 7:102095112-102095134 GCCTTAAGCCCCCCAGTAGCTGG + Intronic
1031661227 7:124427142-124427164 GCTTAAAGTCCCCCAGCAGAAGG - Intergenic
1032751085 7:134842251-134842273 GCCTGAATTCACCCAGCTAGTGG - Intronic
1032856880 7:135842312-135842334 CCCTCCAGCCCCCCAGCTGCAGG + Intergenic
1033231802 7:139604079-139604101 ACCTCCAGTCCGCCAGCTGCTGG + Exonic
1033326485 7:140383342-140383364 ACCTGTAGTACCCCAGCTACTGG + Intronic
1034383744 7:150720804-150720826 GGCTGAAGTCCCCCAGGAGCTGG + Exonic
1034803029 7:154064560-154064582 GACTGAAGTCCCACAGCCTCTGG - Intronic
1034982577 7:155488403-155488425 CCCTGGAGGCCCCCAGCTGAGGG + Intronic
1036175016 8:6529177-6529199 GCCTGAAGGCGTCCATCTGCAGG + Intronic
1036758708 8:11491585-11491607 GCCTGAAGCTCCCCAGCCCCTGG - Intergenic
1037554027 8:20004623-20004645 GCCTGGAGTCTCCCTGCTGTTGG - Intergenic
1042877060 8:73449301-73449323 GCCAGAAGGCCGCCACCTGCAGG - Intronic
1046659950 8:116938402-116938424 GTCTGAGGTCCTCCAGCAGCGGG - Exonic
1046889892 8:119411308-119411330 TCCTGACTTCCCCCAGCTTCTGG + Intergenic
1047708588 8:127526822-127526844 GCCTGAAGTTCCCAAAGTGCTGG + Intergenic
1048461505 8:134625334-134625356 GCCTGCATTCCCCTATCTGCAGG + Intronic
1049241509 8:141539678-141539700 GCCTGAGGTCACCCAGCTTGCGG + Intergenic
1049469680 8:142769743-142769765 CCCTGGACTCACCCAGCTGCAGG + Intronic
1052248566 9:26369277-26369299 GGCTGAAGTCACCTAGCTCCAGG + Intergenic
1052272459 9:26640971-26640993 ACAAGAAGTCCCCCAGCTGTAGG + Intergenic
1053012594 9:34643093-34643115 GCCTGTAGTCCCCCAGCTCTTGG - Intronic
1053024347 9:34718042-34718064 CCCTGACATACCCCAGCTGCTGG + Intergenic
1055754502 9:79543299-79543321 GCCTGAATTCCCCCTGCAGGTGG - Intergenic
1057341638 9:94207332-94207354 GCCTGAGAGCCTCCAGCTGCAGG + Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1059250740 9:112886011-112886033 GGCTGAAATCTCCCAGCCGCTGG - Intronic
1059539094 9:115112878-115112900 GCCTGGAATCCCCCTGCTCCAGG - Intronic
1061315105 9:129790517-129790539 ACATGAAGTCTCCCAGCTGTGGG + Intergenic
1061508918 9:131048791-131048813 GCCTGAAGACCCCCACATGGGGG - Intronic
1062021128 9:134319891-134319913 GCCTGCAGCCCTCCAGCTCCAGG - Intronic
1062439299 9:136562551-136562573 GCCTGAGGTCACCCAGCTTCAGG - Intergenic
1062573188 9:137194820-137194842 GCCTGAAGACCCCGAGACGCAGG + Intronic
1203530819 Un_GL000213v1:140311-140333 GCCAGAAGCCCCACAGCTGTTGG - Intergenic
1185826777 X:3258792-3258814 GCCTGAAGTCCCCCAGAAATGGG - Intergenic
1187450784 X:19394410-19394432 GCCTGAAGTCACACAGCTTGTGG + Intronic
1191253968 X:58271888-58271910 GCCAGAAGTCCCCCAGTGGATGG - Intergenic
1192905536 X:75546728-75546750 TCCTCAAGTCTCCCAGCAGCAGG + Intergenic
1198725740 X:139675549-139675571 GACTCAGGTCCCTCAGCTGCAGG + Intronic
1198927907 X:141820616-141820638 GTCTAGAGTCCCCAAGCTGCTGG + Intergenic
1201252100 Y:12069528-12069550 GCCTGAAGTCCCCCAGAAACTGG + Intergenic