ID: 1137580792

View in Genome Browser
Species Human (GRCh38)
Location 16:49632400-49632422
Sequence TCCCCAGGTGTGCCCACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137580784_1137580792 21 Left 1137580784 16:49632356-49632378 CCTCAGGGAGGGAAGGGGTGGGC 0: 1
1: 1
2: 6
3: 65
4: 717
Right 1137580792 16:49632400-49632422 TCCCCAGGTGTGCCCACACAGGG 0: 1
1: 0
2: 2
3: 20
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137580792 Original CRISPR TCCCCAGGTGTGCCCACACA GGG Intronic
900170063 1:1262893-1262915 GCCCCAGGTGCCACCACACAGGG + Intronic
900171466 1:1271143-1271165 TCCCCAGGAGGGCCCCCACCAGG + Intronic
900293944 1:1939319-1939341 TCCCCTGCTGGGGCCACACAAGG - Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
901140227 1:7024308-7024330 CACCCTGATGTGCCCACACATGG - Intronic
901379737 1:8865110-8865132 CCCCCAGTTGTGCATACACAGGG - Intronic
902380721 1:16051062-16051084 TCCCCAGGTGTGCACAGAGCTGG + Intronic
902512142 1:16972353-16972375 TCCCCAGGTGTCCACACTGAAGG + Exonic
904301449 1:29557267-29557289 TGACCAGCTGTGCCCCCACAGGG - Intergenic
904319790 1:29689449-29689471 TCCCCAGCTGTGCCCACCCGGGG + Intergenic
904576180 1:31506443-31506465 TCCGCATGTGTGCCCAGGCATGG + Intergenic
905175201 1:36130981-36131003 TCTCCAGGCCTGCCCACACTAGG + Intergenic
905212980 1:36386847-36386869 TAGACACGTGTGCCCACACATGG - Intergenic
907559470 1:55375455-55375477 TCCACATGTGTGTCCACAAAAGG - Intergenic
908666548 1:66497672-66497694 TCCCAAGGAGTGCTCAAACAAGG + Intergenic
911024952 1:93426674-93426696 TGGCCAGGTGTGCACACACTCGG + Intergenic
913479644 1:119275374-119275396 AGGCCAGGTGAGCCCACACAGGG - Intergenic
917791823 1:178504014-178504036 TCCCCAGGAGGGGCCATACATGG + Intergenic
922555327 1:226528145-226528167 TCCCCAGGTGAGCCTCCAGAGGG - Intergenic
922809834 1:228409274-228409296 TCCTCCGGTGGGCACACACAGGG + Exonic
923804957 1:237247636-237247658 TCCCATGGTGTGCCCACTCCTGG - Intronic
1062925051 10:1309904-1309926 GCCCCAGGTGTGCCCGCAGGTGG - Intronic
1066554487 10:36596384-36596406 TGCCCAGGTATGCTAACACAGGG + Intergenic
1067237324 10:44461869-44461891 GCACCAGGTGGGCCCAGACAGGG + Intergenic
1069858667 10:71456464-71456486 GCTCCAGATGTGCCCAGACAGGG - Intronic
1070664159 10:78331813-78331835 TCCCCAGCTGCACCCCCACAAGG - Intergenic
1072265341 10:93721804-93721826 TTCCCAGGAGTGCCCAGACATGG + Intergenic
1072412106 10:95212367-95212389 TCCCCAGTTCTTCCCTCACAGGG - Intronic
1074111090 10:110423306-110423328 TCACCAGGGTTGCCCACCCAAGG + Intergenic
1076691701 10:132226989-132227011 TCCCCAGCTGTGCGCACAACAGG - Intronic
1076788908 10:132766499-132766521 GCACCAGGTCTGCACACACACGG - Intronic
1076821843 10:132943401-132943423 TCCCCTAGTGTGCCCACCCCGGG - Intergenic
1077268047 11:1661672-1661694 GGCCCAGGTGTGACAACACAGGG + Intergenic
1077372891 11:2191978-2192000 TCCCATGGGGTGTCCACACAGGG - Intergenic
1078171613 11:8932872-8932894 TCCACAGGTCTGACCCCACAAGG + Intronic
1080030778 11:27658443-27658465 TACCCAGGTGTGCGGACCCATGG - Exonic
1081845278 11:46237089-46237111 TCCCCTGCTCTGGCCACACAGGG - Intergenic
1082081203 11:48013763-48013785 TCCCCAGGTGGCCGCCCACAGGG - Intronic
1083172407 11:60930754-60930776 TCCCCAGGTGAGCAGACCCAAGG + Intronic
1083823145 11:65183589-65183611 TCCCCAGGGGAGCCCTCACCTGG - Exonic
1086498387 11:87427001-87427023 TCCCAAGGTGTGCCTGCTCAAGG - Intergenic
1089561210 11:119344131-119344153 TACCCAGATGTTCCCACACTGGG - Intronic
1091583613 12:1803418-1803440 TCCCCAGATGCGCCCACACCAGG + Intronic
1103536599 12:121637750-121637772 CCCCCAGGCCTGCCCACACCTGG - Intronic
1104971894 12:132534537-132534559 GCCCCACATGTGCCCACACAGGG + Intronic
1106515010 13:30445691-30445713 TCCCCACGTGTGCACCCAGAAGG + Intergenic
1107309298 13:39060067-39060089 TGCCCAGGTGTCACCACACCAGG + Intergenic
1108505046 13:51105255-51105277 GCCCCAGCTGTAACCACACAGGG - Intergenic
1108854481 13:54775753-54775775 TGTCCAGGTGTGCACACACTTGG - Intergenic
1109622263 13:64925630-64925652 GCCCCAAGTGTGCACACACCTGG + Intergenic
1113875069 13:113589119-113589141 TCTCCAGCTGGGCCCACTCAAGG - Intronic
1117285535 14:54282795-54282817 ACCCCAAGTGTGCACACACATGG + Intergenic
1119348455 14:73944870-73944892 TTCCCAGGTGTGGCTCCACAAGG - Exonic
1119873684 14:78038168-78038190 GCACTAGGTGTGCTCACACACGG + Intergenic
1121404397 14:93710444-93710466 TACCCAGGAGAGCCCAAACATGG + Intergenic
1121664816 14:95664506-95664528 TCCCCTCGTGTGCTCCCACATGG - Intergenic
1122171330 14:99877856-99877878 TCCCCAGCTGTGGCAACAGAAGG + Intronic
1125723578 15:41856834-41856856 TCCCCGGGTGGGCCCACACCTGG + Exonic
1125832829 15:42728677-42728699 TTCCCAGCTGTGCCCTCACGGGG - Exonic
1129183492 15:73891729-73891751 GCCCCAGGTGTGAGCACACCTGG - Intergenic
1129293673 15:74587586-74587608 TCCCCAGGTCCCCTCACACAGGG - Intronic
1129718694 15:77866208-77866230 TCACCTGGTTTGCCCACTCAGGG + Intergenic
1130460230 15:84154656-84154678 TCACCTGGTTTGCCCACTCAGGG - Intergenic
1131177255 15:90217823-90217845 CCCACAGGTGAGCCCACACCTGG + Exonic
1132306609 15:100819462-100819484 CCCCCAGGCATGCCAACACATGG + Intergenic
1132744178 16:1429850-1429872 TCGCCAGGTGTGCCCCCGCTTGG - Intergenic
1132794469 16:1712647-1712669 TCCCCAGGTGGCCCCCCACTGGG + Intronic
1133140052 16:3737025-3737047 TCCCTTGGGGTGCACACACAGGG + Intronic
1133750652 16:8722760-8722782 TCCCCAGATGCGCCCATCCAGGG + Intronic
1135560904 16:23476072-23476094 TTCCCAGGTGTGATCACAAAGGG + Intronic
1136267822 16:29131369-29131391 CCTCCGGGTGTGACCACACAGGG + Intergenic
1137023437 16:35452144-35452166 TCCCCAGGTGTCCCCAGAGGGGG + Intergenic
1137580792 16:49632400-49632422 TCCCCAGGTGTGCCCACACAGGG + Intronic
1138977325 16:62223461-62223483 ACGCCAAGTGTACCCACACATGG + Intergenic
1139337058 16:66240192-66240214 TCTGCACATGTGCCCACACAGGG - Intergenic
1140176635 16:72667209-72667231 GACACAGGTGTGCACACACATGG - Intergenic
1141145505 16:81526969-81526991 TTCCCAGGAGTGAGCACACAGGG + Intronic
1141271070 16:82541672-82541694 ACCCCAGGTGTGCGCTCACTGGG - Intergenic
1142071126 16:88091716-88091738 CCTCCGGGTGTGACCACACAGGG + Intronic
1143322606 17:6077873-6077895 TCTCCAGGTCTGCTCACAAAGGG - Intronic
1145416472 17:22717402-22717424 TGCCCAGTTGGGCCCACAAAGGG - Intergenic
1145964409 17:28906671-28906693 CCCACAGGTGTGTACACACATGG + Intronic
1146054926 17:29576257-29576279 TCCCCAGGGGGGCCCCCAAAGGG + Exonic
1147466458 17:40614850-40614872 TCCCCAGCTGCACCCACACCAGG - Intergenic
1147550337 17:41437439-41437461 TCCACAGGTGGGCCCACAGGTGG + Exonic
1148243185 17:46013221-46013243 CCCTCAGGTGACCCCACACAAGG + Intronic
1148328043 17:46795295-46795317 TCCCCAGTTCTGGCCACACCAGG - Intronic
1149333153 17:55607160-55607182 TGCTCATGTGTGCACACACATGG + Intergenic
1150952739 17:69821521-69821543 TGGCTAGGTGTGCACACACAGGG + Intergenic
1151128204 17:71867697-71867719 TCCCCAGCAGTACCCACAAATGG - Intergenic
1151473186 17:74330654-74330676 GCCCATTGTGTGCCCACACACGG + Intronic
1152768109 17:82151826-82151848 ACGCCAGGGGTGCCCACCCAAGG + Intronic
1153972784 18:10241571-10241593 TCCCCAGGTGTGCTCTGCCAGGG - Intergenic
1156622934 18:38874236-38874258 TCCCCAGCTCTGTCCACTCAGGG + Intergenic
1157226295 18:45868078-45868100 TCCTCAGGTGTGCCAGGACAGGG + Intronic
1159851971 18:73535300-73535322 TCCCCACGTGTGCCCAGGCATGG - Intergenic
1161511567 19:4675113-4675135 ACCCCAGGAGTCCCCACAGATGG + Intergenic
1161582149 19:5086871-5086893 AGCCCAGGTCTGCCCCCACAGGG + Intronic
1161943258 19:7419025-7419047 ACCCCAGATGTACCCACACTCGG + Intronic
1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG + Intronic
1161943278 19:7419114-7419136 ACCCCAGATGTACCCACACTCGG + Intronic
1161943293 19:7419174-7419196 ACCCCAGATGTACCCACACTCGG + Intronic
1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG + Intronic
1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG + Intronic
1161943481 19:7419936-7419958 ACCCCAGGTGTACTCACACTCGG + Intronic
1161943488 19:7419966-7419988 ACCCCAGGTGCGCCCACACTCGG + Intronic
1162148209 19:8626595-8626617 TCCCCAGCTGAGGTCACACAAGG - Intergenic
1163167967 19:15510552-15510574 TGTCCAGGTGTGGCCACACTTGG + Intronic
1163476919 19:17532063-17532085 TTCCCAGCTGTGCCCACCCAGGG + Intronic
1164503499 19:28839275-28839297 TCCCCCGGAGTGCACACACAGGG - Intergenic
1165416327 19:35696013-35696035 ACACCAGGAGTGCACACACACGG + Intergenic
1167037232 19:47001628-47001650 TCCCCAGCTGTCCCCACCAAGGG - Exonic
1167207623 19:48113240-48113262 CCCCTGGGTCTGCCCACACAGGG + Intergenic
1168121471 19:54254548-54254570 TCCCCAGGCATGCCCACACTTGG - Intronic
925294559 2:2768608-2768630 TTCCCAGGTGTGGCTGCACATGG + Intergenic
925341215 2:3138762-3138784 TCCCCCAGTGTGGCCACACCTGG + Intergenic
925341218 2:3138765-3138787 ACTCCAGGTGTGGCCACACTGGG - Intergenic
925803649 2:7627241-7627263 TGCTCAGTTGTGCTCACACAGGG - Intergenic
926421627 2:12705346-12705368 TCCATAGGTCAGCCCACACATGG - Intergenic
926564262 2:14452597-14452619 TCCCCAGCTGTGGCTACAGAGGG - Intergenic
927980791 2:27373839-27373861 TCCCCATGTGTGCTCACAACAGG + Exonic
929608223 2:43249950-43249972 TCCCCAGGTCTGCTCTGACAAGG - Intronic
930021337 2:47003845-47003867 TCCCCAGCTCTGGCCACCCAGGG - Intronic
931011579 2:57921432-57921454 TCCCCAGGAGGATCCACACAAGG - Intronic
932288042 2:70553479-70553501 TTCCCAGGTGTTCTCACGCACGG + Intronic
933134343 2:78713021-78713043 TCCCCATTTTTGCCCACACTGGG + Intergenic
933308975 2:80637154-80637176 TCACCAGGTGAGTCCAAACATGG - Intronic
937018830 2:118632377-118632399 TCACCGCGTGTGCACACACATGG + Intergenic
937527194 2:122786059-122786081 TCCCCAGGTGTGATCAGAGATGG - Intergenic
937900082 2:127013150-127013172 TCCACACGTGTGGGCACACATGG - Intergenic
938540421 2:132280259-132280281 GCCCCAGTTGTGGCCACCCATGG - Intergenic
938780020 2:134576363-134576385 CCCCCAGGTGTGGCCATACCAGG - Intronic
941151352 2:161919102-161919124 TGGCCAGGTGTGCACACACTTGG + Intronic
941373010 2:164691120-164691142 TCTCCATGTTTGCCCAGACAGGG + Intronic
943048605 2:182888857-182888879 TCCCTAGAAGTGACCACACAGGG - Intergenic
947746000 2:232507689-232507711 TCCCCACATGTGCACACACATGG + Intergenic
948752475 2:240140429-240140451 TCCCCAGGGCTGCCCACACTGGG - Exonic
948853616 2:240720047-240720069 TCTCCAGCTGTGCCCACAGTGGG + Intronic
1169512641 20:6280948-6280970 TCCCCAGGTCTTACCAGACAAGG - Intergenic
1170458307 20:16553899-16553921 TCCCTAAGTGTGCGCACACCTGG - Intronic
1173714225 20:45188214-45188236 TTCACAGGTGTGACCTCACAAGG + Intergenic
1175688118 20:61046073-61046095 TCCCCAGGTGTGTCTCCACAGGG + Intergenic
1175688135 20:61046148-61046170 TCCCCAGGTGTGTCTCCACAGGG + Intergenic
1175759887 20:61555012-61555034 CACACAGGTGTGCACACACATGG - Intronic
1175914898 20:62421332-62421354 GGCTCAGGTGTGCACACACATGG - Intronic
1176090880 20:63318174-63318196 TCTCCAGGTGCGGCCACCCAGGG + Intronic
1179005018 21:37506217-37506239 TCCCCAGGTGAGCTCGCACGTGG + Exonic
1179887807 21:44321912-44321934 GCCCCAAGTGTGCACACAGAAGG - Intronic
1180065650 21:45410923-45410945 TGCCCAGGTGTGTCCAGACGAGG - Intronic
1181023785 22:20116611-20116633 ACCCCATCTGTCCCCACACAGGG - Exonic
1181629421 22:24142780-24142802 GCCCCAGGACTGTCCACACAGGG + Intronic
1182265671 22:29113189-29113211 GCCTTATGTGTGCCCACACAAGG + Intronic
1183281700 22:36935859-36935881 TTCCCTGGAGTGCCCACACCTGG + Intronic
1183485440 22:38085670-38085692 TCCCGAGGTGAGTCCTCACATGG - Exonic
1185008593 22:48300166-48300188 GCCCCATGAGGGCCCACACAGGG + Intergenic
954401976 3:50323732-50323754 TCCCCGGGGGTCCCCACCCATGG - Intronic
954663575 3:52238834-52238856 CCCCCAGATGTGCCCACCCCAGG + Intronic
955993100 3:64649636-64649658 TTCTCAGGTGTGCCCATATATGG - Exonic
957001658 3:74893510-74893532 TTCACAGGTGTGCACAGACATGG + Intergenic
959193733 3:103149915-103149937 TCTCCATGTGTTTCCACACATGG + Intergenic
959897023 3:111617033-111617055 GCCCCAAGTGTGCACACACCTGG - Intronic
965261290 3:166489423-166489445 CCTCCAGGTGTGCACACACTGGG + Intergenic
966770644 3:183500751-183500773 TCCATAGGTGTGCTGACACAAGG + Intronic
968447526 4:659424-659446 TCCGCATGTGTGCACGCACATGG + Intronic
968594941 4:1477376-1477398 TCCCCAGGTGGACCCGCCCACGG - Intergenic
968744830 4:2354152-2354174 TCCCAGGCTGAGCCCACACATGG - Intronic
970375611 4:15454302-15454324 TATCAAGGTGTGTCCACACAAGG + Intergenic
971315898 4:25567661-25567683 TCCCCAGATTTGGCCACAGATGG - Intergenic
971378756 4:26077510-26077532 TCTGAAGGTGTGCCCGCACATGG + Intergenic
974733963 4:65904037-65904059 TCCCCAAGTGTGAGCACACGTGG + Intergenic
975544282 4:75545744-75545766 TCCGCAGTTGTGACCACAGATGG + Intronic
979714597 4:123822574-123822596 TGCCTAGCTGTGCCCTCACATGG + Intergenic
985924857 5:3007786-3007808 TGCCACGGTGAGCCCACACATGG + Intergenic
986179925 5:5384077-5384099 TCTCCAGATCTTCCCACACAAGG - Intergenic
989536078 5:42565120-42565142 GCTCCAGGTGTGGCCACACTGGG + Intronic
990568547 5:57054837-57054859 TCCCCAGGTGTGCCCATGGGAGG - Intergenic
991634395 5:68689842-68689864 TCCCCAAGAGTCCCCTCACATGG + Intergenic
993671427 5:90765293-90765315 TCTCGAGGTGTGGCCACACAGGG - Intronic
994157819 5:96523203-96523225 CTGCCTGGTGTGCCCACACATGG + Intergenic
996016123 5:118535736-118535758 TCCCCTGGATCGCCCACACATGG - Intergenic
996047373 5:118888748-118888770 TCCACAGCTTTGCCAACACATGG + Intronic
996702686 5:126465857-126465879 ACACCAGGTGTGCACACCCAAGG - Intronic
999689685 5:154135971-154135993 TCCCCAGGTGTTCCCAAGCCTGG - Intronic
999887237 5:155936923-155936945 GCCCCGGGTGTGCGCACACCTGG + Intronic
999887240 5:155936926-155936948 TGGCCAGGTGTGCGCACACCCGG - Intronic
1001491878 5:172161833-172161855 TGCCCAGGTGTGCACACTCTTGG + Intronic
1002127860 5:177060230-177060252 TACCCAGGTGTGGCCAGGCACGG + Intronic
1005781869 6:29201314-29201336 TGGCCTGGTGTGCCCACACTTGG + Intergenic
1005854253 6:29848577-29848599 TCTGCAGCTGTGCCCACACTTGG - Intergenic
1006193017 6:32220962-32220984 CCCCCAGGTGTGTCCTCACAGGG - Exonic
1006319600 6:33312743-33312765 TCCCCACCTGCGCCCACACCCGG - Intronic
1006505370 6:34485736-34485758 TCCCTGGGTGGGCCCTCACAGGG - Intronic
1007077981 6:39079861-39079883 TCCCCAGGTGTCCCAATACCTGG + Intronic
1007268462 6:40616569-40616591 TCCCCCGCTGTGTCCTCACATGG + Intergenic
1011197617 6:84798319-84798341 TCCACAGATGTGTCCACAGAAGG - Intergenic
1013198166 6:107864206-107864228 TTCCCTGTTGTGCCCACAGAGGG - Intergenic
1017764383 6:157594694-157594716 AACCCTGGTGTGCCCCCACATGG - Intronic
1019752068 7:2737074-2737096 TCCCCAGTGGGACCCACACATGG - Intronic
1020586707 7:10078769-10078791 GCCCCAGGTATGCACACACCCGG - Intergenic
1021094299 7:16517885-16517907 TCACCATGTGTGGCCAGACATGG - Intronic
1023847505 7:44130880-44130902 TCCCCAGTGGTGTGCACACAGGG + Intergenic
1024056588 7:45663420-45663442 TCCCCAGCTGTGCTCATTCAGGG + Intronic
1024264667 7:47597538-47597560 CACCTAGGTGTGCCCACAGAAGG + Intergenic
1024548919 7:50544185-50544207 TGCCCAGGTGTCCCTACCCACGG - Intronic
1025250953 7:57351059-57351081 TTCCCTGGTCTGCTCACACATGG + Intergenic
1026023405 7:66727715-66727737 TCCCCAGGTGTGCCCACTTCTGG - Intronic
1026991551 7:74588873-74588895 TCCCCAGACTTGCCCACAGAGGG + Intronic
1027053078 7:75031913-75031935 TCCCCATGTGGGCCAACCCACGG + Intronic
1027296699 7:76780898-76780920 TGCCCAGCTGTGTCCTCACATGG - Intergenic
1027707786 7:81555655-81555677 TGCTCAGGCCTGCCCACACACGG + Intergenic
1029392720 7:100286332-100286354 TCTCCAGGTCTGCTCACACTTGG - Intergenic
1030514124 7:110519675-110519697 TGGCCAGGTGTGCACACACTTGG - Intergenic
1032311340 7:130790101-130790123 TCCCCAGGTGCCACCACATATGG - Intergenic
1034276472 7:149826090-149826112 GTCCCTGGTGTGCCCACACCAGG + Intergenic
1035048274 7:155983354-155983376 TCCCCAGCTCTGCCCACCCTGGG - Intergenic
1035274520 7:157739654-157739676 TCCCCAGGTGTGACCAGACAAGG + Intronic
1035376597 7:158410867-158410889 TGCCCAGGTGACCCCAGACACGG + Intronic
1036484112 8:9164164-9164186 TCCCCAAGTGTCCCCTCTCATGG - Intronic
1037344030 8:17879344-17879366 TCCCCAGCAGTGTCAACACAAGG + Intronic
1038416905 8:27403710-27403732 CACCCAGACGTGCCCACACAGGG + Intronic
1038581249 8:28751066-28751088 TCCCCGGGGTTCCCCACACAGGG + Exonic
1038951753 8:32422968-32422990 TTCCCAGGTGATCTCACACATGG - Intronic
1039654828 8:39392205-39392227 TCTCAAGGGGAGCCCACACATGG + Intergenic
1040542699 8:48374177-48374199 TACCCTGCTGTGCCCAGACATGG + Intergenic
1040900608 8:52413928-52413950 TTCCCATCTGTGCCCACCCACGG - Intronic
1041955995 8:63558676-63558698 GCCCCAAGTGTGCGCACACCTGG - Intergenic
1043523754 8:81074027-81074049 TCTGCACGTGTGCCCACACCTGG - Intronic
1046978976 8:120315754-120315776 TCCCCAGGTGAGCTCTGACAGGG + Intronic
1047247540 8:123158416-123158438 TCCCCAGGGGTCCCCACGCCTGG - Intergenic
1048278400 8:133085117-133085139 TCACCAGCTGTGTCTACACACGG - Intronic
1048998143 8:139806847-139806869 TCCTCTGGTGTGCACACGCACGG + Intronic
1049379068 8:142303028-142303050 TCCCCAGATGCCCACACACACGG - Intronic
1052669035 9:31532016-31532038 CCCCCACGTGTCCACACACAGGG + Intergenic
1052863026 9:33448259-33448281 TCCACAGCTGTGTCTACACATGG + Intergenic
1054798972 9:69327706-69327728 TCCTCTGGTGTGCCCAGACCTGG - Intronic
1056767547 9:89454341-89454363 TCTCCAGGAGTGGCCACAGAAGG + Intronic
1057065450 9:92045666-92045688 TCTCCATGTCTGCACACACAGGG - Intronic
1057441920 9:95089578-95089600 TCCCCAGGAGTGCCTGGACACGG - Intergenic
1057730749 9:97606042-97606064 GCCACAGGTGGGCACACACAAGG + Intronic
1060207589 9:121691309-121691331 TCCCCGGATGTCCCCACACTAGG - Intronic
1060861365 9:126957369-126957391 TCCCAAGGGGAGCCCAGACATGG - Intronic
1060961164 9:127681764-127681786 TCCCCAGTGGTGCCCGGACAGGG + Intronic
1061878471 9:133556673-133556695 TGCCCAGGTGTCCCCAGACATGG - Intronic
1062329566 9:136032032-136032054 TGCCCAGGTTTGACCACAGAAGG + Intronic
1186157799 X:6743747-6743769 TCCCCAGGTGTGCCATGACAGGG + Intergenic
1190362425 X:49661979-49662001 ACCCCAGCTGGGCCCACAGAAGG - Intergenic
1191202003 X:57793329-57793351 TCCACAGGTGTGCTAACTCAGGG - Intergenic
1192152114 X:68718908-68718930 TCCCCAGCTTTGCCCATTCAGGG + Intronic
1195861986 X:109392871-109392893 TCCTCAGGTGTTCTCACATACGG + Exonic
1197853405 X:130889144-130889166 GCCCCAGGTGTGGCCACCCCAGG - Intronic
1198324127 X:135550548-135550570 TCCCCTCCTGAGCCCACACAAGG - Intronic
1202379022 Y:24260517-24260539 TCACCTGGTCTGCCCACTCAGGG + Intergenic
1202491760 Y:25409604-25409626 TCACCTGGTCTGCCCACTCAGGG - Intergenic