ID: 1137581023

View in Genome Browser
Species Human (GRCh38)
Location 16:49633668-49633690
Sequence ATGCCCCCCTAGAAAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137581015_1137581023 17 Left 1137581015 16:49633628-49633650 CCACCTGACTCCAAGGCCAAAAC 0: 1
1: 0
2: 3
3: 23
4: 196
Right 1137581023 16:49633668-49633690 ATGCCCCCCTAGAAAGGCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 105
1137581014_1137581023 22 Left 1137581014 16:49633623-49633645 CCAGGCCACCTGACTCCAAGGCC 0: 1
1: 0
2: 5
3: 102
4: 649
Right 1137581023 16:49633668-49633690 ATGCCCCCCTAGAAAGGCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 105
1137581018_1137581023 1 Left 1137581018 16:49633644-49633666 CCAAAACATTCCCTGAGAGCACC 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1137581023 16:49633668-49633690 ATGCCCCCCTAGAAAGGCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 105
1137581020_1137581023 -10 Left 1137581020 16:49633655-49633677 CCTGAGAGCACCTATGCCCCCCT 0: 1
1: 0
2: 2
3: 10
4: 131
Right 1137581023 16:49633668-49633690 ATGCCCCCCTAGAAAGGCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 105
1137581019_1137581023 -9 Left 1137581019 16:49633654-49633676 CCCTGAGAGCACCTATGCCCCCC 0: 1
1: 1
2: 1
3: 11
4: 129
Right 1137581023 16:49633668-49633690 ATGCCCCCCTAGAAAGGCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 105
1137581013_1137581023 23 Left 1137581013 16:49633622-49633644 CCCAGGCCACCTGACTCCAAGGC 0: 1
1: 0
2: 10
3: 108
4: 652
Right 1137581023 16:49633668-49633690 ATGCCCCCCTAGAAAGGCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 105
1137581016_1137581023 14 Left 1137581016 16:49633631-49633653 CCTGACTCCAAGGCCAAAACATT 0: 1
1: 0
2: 1
3: 22
4: 231
Right 1137581023 16:49633668-49633690 ATGCCCCCCTAGAAAGGCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 105
1137581017_1137581023 7 Left 1137581017 16:49633638-49633660 CCAAGGCCAAAACATTCCCTGAG 0: 1
1: 0
2: 1
3: 17
4: 232
Right 1137581023 16:49633668-49633690 ATGCCCCCCTAGAAAGGCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137581023 Original CRISPR ATGCCCCCCTAGAAAGGCTG AGG Intronic
900619252 1:3579514-3579536 CTGGCCCCCTAGAAAGGCAGGGG - Intronic
904470178 1:30731137-30731159 AGGGACCCCTACAAAGGCTGGGG - Intergenic
905462621 1:38131592-38131614 ATGCCCTCCAGGACAGGCTGGGG - Intergenic
905923087 1:41732046-41732068 ATGGTCCTCTAGGAAGGCTGTGG + Intronic
912204091 1:107491626-107491648 CTGCCCCCAAAGAAAGGGTGTGG - Intergenic
914333699 1:146696771-146696793 ATGCCCGCCACCAAAGGCTGTGG + Intergenic
920490935 1:206414625-206414647 AAGACCCCCAAGAAAGGCTGTGG + Intronic
922902864 1:229150845-229150867 ATTCCTCCCCAGAAAGACTGAGG + Intergenic
1063321546 10:5056770-5056792 ATGCCTCCCTAATAAGGATGTGG + Intronic
1070688029 10:78504321-78504343 ATGACCCCATGGAAGGGCTGGGG - Intergenic
1071832368 10:89384372-89384394 AGGCCACCACAGAAAGGCTGAGG + Exonic
1072427706 10:95343951-95343973 ATGCCCCCCAAAGAGGGCTGTGG - Intronic
1072745334 10:97935630-97935652 ATGCCAGCCTAGAGATGCTGAGG - Intronic
1074053163 10:109898234-109898256 ATGCCCACCTTGAAGGGTTGAGG + Intronic
1075386911 10:122061619-122061641 CCGACCCCCTAAAAAGGCTGGGG - Intronic
1077092737 11:787027-787049 ATCCCTCCCTGGAAAGCCTGGGG + Intergenic
1077155894 11:1090653-1090675 ATGCCCCTCTGGGAAGGCCGGGG - Intergenic
1080879101 11:36302459-36302481 AAGCCCCCCTAGTTATGCTGTGG - Intronic
1082192398 11:49262551-49262573 AGGCCTCCTTAGAGAGGCTGAGG + Intergenic
1083144462 11:60748444-60748466 CTGCCCCCCTGGAAGGGCGGAGG - Intergenic
1083488194 11:62996523-62996545 ATGCAGCCCAAGGAAGGCTGGGG - Intronic
1084437317 11:69151477-69151499 CTGTCACCTTAGAAAGGCTGTGG - Intergenic
1085788171 11:79473239-79473261 GGGCCCCCTGAGAAAGGCTGAGG + Intergenic
1086673724 11:89578408-89578430 AGGCCTCCTTAGAGAGGCTGAGG - Intergenic
1086983279 11:93221872-93221894 ATTCCCCTCTAGAAAGTTTGGGG - Intergenic
1087027183 11:93661486-93661508 ATGGGCCCCTAGGCAGGCTGGGG + Intergenic
1088585922 11:111360149-111360171 CTGCCCACCTAGACAGCCTGTGG + Intronic
1089607727 11:119651417-119651439 ACCCCCCCCAAGAAAGACTGGGG - Intronic
1091100549 11:132868957-132868979 ATGCGCCCCTGGAGAAGCTGTGG + Intronic
1092159131 12:6306126-6306148 ATGCGGCCCCAGAGAGGCTGTGG - Intergenic
1092594376 12:9985388-9985410 ATGCCACCCTAGCAACGCTGTGG - Exonic
1094421762 12:30278713-30278735 ATTGCTCCCTAGAAAGGGTGTGG + Intergenic
1096389691 12:51218446-51218468 CTCCCTCCCTAGAAAGGCGGGGG + Intergenic
1103119744 12:118371673-118371695 AGCCCCCCCAAGAACGGCTGCGG - Intronic
1104105896 12:125658829-125658851 ATTCTGGCCTAGAAAGGCTGTGG + Exonic
1106466688 13:30019973-30019995 GGGACCCCCTGGAAAGGCTGGGG - Intergenic
1111048531 13:82847340-82847362 TTGCCCCTCTAGAAGTGCTGAGG + Intergenic
1113454242 13:110436920-110436942 AGGAAGCCCTAGAAAGGCTGTGG - Intronic
1123787932 15:23690921-23690943 GTGGCCCCCTAGGGAGGCTGGGG - Intergenic
1124024773 15:25955231-25955253 ATGCCCTCCAAGAAAAGCTCTGG - Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1133222085 16:4323199-4323221 ATGCACGCCCAGCAAGGCTGGGG - Intronic
1137581023 16:49633668-49633690 ATGCCCCCCTAGAAAGGCTGAGG + Intronic
1137714420 16:50589626-50589648 ACGCTCCCCTATAAAGGCAGCGG + Intronic
1139391822 16:66610198-66610220 TGCCCCTCCTAGAAAGGCTGGGG - Intronic
1139999918 16:71014478-71014500 ATGCCCGCCACCAAAGGCTGTGG - Intronic
1141627445 16:85268741-85268763 ATGCCCCCCGAGGAAGGCAGAGG - Intergenic
1142767174 17:2071501-2071523 AAGCCCCCTCTGAAAGGCTGCGG - Intronic
1148385543 17:47232065-47232087 GTTCCCCCCCAGCAAGGCTGAGG - Intergenic
1148454027 17:47801275-47801297 GTGTCTCCCCAGAAAGGCTGGGG - Intergenic
1157523239 18:48359842-48359864 AAGCACCCCTAGAAGGGCAGGGG - Intronic
1166805758 19:45485937-45485959 ATGTCCCCTTGAAAAGGCTGAGG - Intronic
929579160 2:43070835-43070857 ATGCCCCCCAAGAAAGCGCGGGG - Intergenic
931616837 2:64167873-64167895 ATTCTCCCATAGAAAGGCTGAGG + Intergenic
937297769 2:120820090-120820112 ATCCACCCTTAGAAAGACTGAGG + Intronic
944473223 2:200077950-200077972 ATGGGCCCCTAGAAATGTTGTGG + Intergenic
948206266 2:236164278-236164300 TTCCCCCACTCGAAAGGCTGAGG + Intergenic
948361943 2:237428072-237428094 AAGCCACCCCAGAATGGCTGAGG - Intergenic
1173943837 20:46934372-46934394 ATGAACACCTAGAAGGGCTGGGG - Intronic
1175473687 20:59253435-59253457 AAGCCCCCCCAGACAGACTGTGG + Intronic
1184193455 22:42910441-42910463 TGGCCCCCCCAGAGAGGCTGTGG - Intronic
1184340757 22:43884668-43884690 CTGCCCCTCTAGAAAGTCTGTGG + Intronic
960967503 3:123115396-123115418 AAGGCCCCCTATCAAGGCTGTGG + Intronic
961806390 3:129492323-129492345 CTGCCCCCGGAGCAAGGCTGTGG - Intronic
964815777 3:160716484-160716506 ATGCTTCACTAGAAAGGCAGGGG + Intergenic
966938742 3:184731811-184731833 AAGACCCCCTTGAAAGCCTGAGG - Intergenic
968742864 4:2340139-2340161 GTGGCTCCCTAGATAGGCTGGGG - Intronic
969543264 4:7807354-7807376 ATGCGCTCCAAGAAAGGCAGAGG + Intronic
969686979 4:8681114-8681136 ATGCCTCCCCACCAAGGCTGGGG - Intergenic
977884229 4:102238757-102238779 ATGCCTCCCTAATAAGGGTGTGG - Intergenic
981014896 4:139963678-139963700 ATGCCTCCCTATCATGGCTGGGG - Intronic
984081676 4:175255114-175255136 TTGCCTTCCTGGAAAGGCTGAGG + Intergenic
985825520 5:2187982-2188004 ATGCGCACCTGGCAAGGCTGAGG + Intergenic
988374039 5:30409773-30409795 ATGACCTCCTAGAAAAGATGGGG + Intergenic
997200859 5:132009457-132009479 CTGCCACCAGAGAAAGGCTGGGG + Intronic
1000042963 5:157498763-157498785 ATAACCCCCCAGCAAGGCTGGGG + Intronic
1001722675 5:173869406-173869428 AAGCCACCCTGGAAAGGCAGTGG + Intergenic
1006100236 6:31681841-31681863 ACGCCCGCCCAGAAAGACTGCGG + Intronic
1006398240 6:33801006-33801028 CTGCCCTGCTAGCAAGGCTGAGG - Intronic
1007271188 6:40638422-40638444 ATGCCACCCCAGAATGGCTCAGG - Intergenic
1007744003 6:44031096-44031118 ATGCCTCCCTCAAAAGACTGGGG + Intergenic
1009371692 6:62911878-62911900 ATTCCCTCCAATAAAGGCTGAGG - Intergenic
1010261019 6:73816885-73816907 ATGAACCCCTATAAATGCTGAGG - Intronic
1012977859 6:105799364-105799386 ATGCCACCCTAGGAAGACTAAGG + Intergenic
1018247141 6:161834270-161834292 ATCCCCCTCCAGAAAGGCAGTGG + Intronic
1019201649 6:170321286-170321308 ATGCTCAGGTAGAAAGGCTGTGG + Intronic
1021274525 7:18633233-18633255 ATGCCACTGTAGAAAGGATGTGG + Intronic
1023517464 7:41016131-41016153 ATGCCCCCTTACAAAGCCTTTGG - Intergenic
1023755203 7:43409693-43409715 ATGTCCCCCTGGTAAGGCTCAGG + Intronic
1023983928 7:45084585-45084607 ATGCCCTCCTGGGAGGGCTGAGG + Exonic
1024262089 7:47580967-47580989 ATGCGCCCCAAGGAAGCCTGGGG + Intronic
1026352593 7:69530591-69530613 ATGCCCTCTTATAAATGCTGGGG + Intergenic
1030958444 7:115885251-115885273 ATGACCTCCTAGAAAGTCAGTGG + Intergenic
1035585396 8:768953-768975 ATGCCCCCTCACACAGGCTGCGG - Intergenic
1037308700 8:17532260-17532282 ATTCCTCCCTAGAATTGCTGGGG - Intronic
1037789419 8:21923808-21923830 TTTCCCACCTCGAAAGGCTGTGG - Intronic
1039693050 8:39882036-39882058 ATGCCTCCCTAATAAGGTTGTGG + Intergenic
1044607938 8:94063365-94063387 AAGCCCTCCAAGGAAGGCTGTGG - Intergenic
1045418107 8:101986943-101986965 ATGCCCTGCTAGATATGCTGGGG + Intronic
1047114134 8:121821537-121821559 ATGCCCACCTACAAGGACTGAGG + Intergenic
1048857367 8:138696251-138696273 ATGTCCCCCTAAGCAGGCTGTGG - Intronic
1049403865 8:142443010-142443032 ATGCAGGCCTGGAAAGGCTGAGG - Intergenic
1051896948 9:21996694-21996716 ATGCCCCCCTACAGAGGCGGAGG - Intronic
1053158533 9:35796954-35796976 ATACCCTCCTGGAAAAGCTGTGG - Intronic
1056864408 9:90216826-90216848 ATCTTCCCCGAGAAAGGCTGCGG + Intergenic
1056915491 9:90742612-90742634 ATCTTCCCCGAGAAAGGCTGCGG - Intergenic
1061429653 9:130523156-130523178 ATGCGGCCCTAGAAAAGCTCTGG + Intergenic
1061859631 9:133461234-133461256 CTACCCACCTGGAAAGGCTGTGG - Intronic
1185615369 X:1418770-1418792 ATGCCCCCCTAGAAACTCCGGGG - Intronic
1187817315 X:23246932-23246954 ATGCACCTGTAGAGAGGCTGAGG - Intergenic
1190290335 X:48988228-48988250 ATGCACCCCAGGAGAGGCTGAGG - Intronic
1190725854 X:53190152-53190174 ATACTCCCCTAGAAAGGGAGGGG - Intergenic
1192269014 X:69561123-69561145 ATGCCCCCCCAAAAAGGCAAAGG + Intergenic
1202074592 Y:21025650-21025672 ATCCCTCCCTAGTAAGGGTGTGG + Intergenic