ID: 1137581181

View in Genome Browser
Species Human (GRCh38)
Location 16:49634522-49634544
Sequence GAGGGGGTGAGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2605
Summary {0: 1, 1: 0, 2: 17, 3: 289, 4: 2298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137581181_1137581192 -4 Left 1137581181 16:49634522-49634544 CCCTCTGCCCTCCTCACCCCCTC 0: 1
1: 0
2: 17
3: 289
4: 2298
Right 1137581192 16:49634541-49634563 CCTCAAAATCACAGGGTCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137581181 Original CRISPR GAGGGGGTGAGGAGGGCAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr