ID: 1137581181 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:49634522-49634544 |
| Sequence | GAGGGGGTGAGGAGGGCAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2605 | |||
| Summary | {0: 1, 1: 0, 2: 17, 3: 289, 4: 2298} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1137581181_1137581192 | -4 | Left | 1137581181 | 16:49634522-49634544 | CCCTCTGCCCTCCTCACCCCCTC | 0: 1 1: 0 2: 17 3: 289 4: 2298 |
||
| Right | 1137581192 | 16:49634541-49634563 | CCTCAAAATCACAGGGTCCCAGG | 0: 1 1: 0 2: 1 3: 15 4: 192 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1137581181 | Original CRISPR | GAGGGGGTGAGGAGGGCAGA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||