ID: 1137581295

View in Genome Browser
Species Human (GRCh38)
Location 16:49635040-49635062
Sequence ATGTGGAAGGCCCTTTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137581295_1137581299 12 Left 1137581295 16:49635040-49635062 CCACATCAAAGGGCCTTCCACAT 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1137581299 16:49635075-49635097 ACTAACTGAAATGATGCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137581295 Original CRISPR ATGTGGAAGGCCCTTTGATG TGG (reversed) Intronic
901864212 1:12093474-12093496 ATGTGTGAGGCCCTATGATAGGG + Intronic
902396786 1:16136252-16136274 ATGTGCCAGCCCCTGTGATGGGG - Intronic
903112910 1:21152481-21152503 ATGTTGAAGGCCCTGTAAGGGGG - Intronic
903681576 1:25100938-25100960 GTGGGGGAGGGCCTTTGATGTGG - Intergenic
903885554 1:26539067-26539089 ATGTGGTAGGCGCTATGATGGGG + Intronic
906071891 1:43022941-43022963 ATGTGCCAAGCCCTGTGATGGGG + Intergenic
907737340 1:57127401-57127423 ATGTCACAGGCCCTTTCATGAGG + Intronic
908882198 1:68744771-68744793 ATCTGGAAGGTTTTTTGATGTGG - Intergenic
910827711 1:91427591-91427613 ATGTTGATGGCCTTTCGATGGGG + Intergenic
914967027 1:152269304-152269326 ATGTTGAAGACCTTTGGATGGGG + Intergenic
914969342 1:152292813-152292835 ATGTTGAAGACCTTTGGATGGGG - Intergenic
915294241 1:154909002-154909024 ATGTGGCAGGGCCATAGATGGGG + Intergenic
918807228 1:189064492-189064514 ATGTGGAATGCCCTGTGGTTTGG + Intergenic
922018931 1:221684337-221684359 AAATGGAAAGCCCTTTGGTGGGG + Intergenic
924162633 1:241249077-241249099 CTGTGGAAGACCCTGTGAAGAGG - Intronic
1063931729 10:11035363-11035385 ATGTGGAGGACCCTGAGATGAGG + Intronic
1071476680 10:86031631-86031653 AGGTGGTAGGGGCTTTGATGAGG - Intronic
1075438155 10:122460304-122460326 ATTTGGAAGGTGCTTTGAGGGGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG + Intronic
1078344442 11:10532980-10533002 ATGTGCAAGGCCCTCTGCTAAGG - Intronic
1078547786 11:12258585-12258607 ACGGGGAAGGCCCCTTGATAAGG + Intronic
1080746093 11:35110015-35110037 GTGTGGTAAGTCCTTTGATGTGG + Intergenic
1084080274 11:66818680-66818702 ACCTGGAAGGGCCTTTGATGGGG - Intronic
1084726205 11:70943824-70943846 ATGTGGTTGGCCCTGTGGTGAGG - Intronic
1085518067 11:77122785-77122807 AGGTGGAAGACCCTCTGACGAGG + Intronic
1087083850 11:94197197-94197219 ATGTGGTTGGCCCTCTGATAGGG + Intergenic
1089096475 11:115923811-115923833 ATGTGGATGTCCCTTTCAGGGGG - Intergenic
1090915238 11:131157182-131157204 AGCTAGAAGGCCCATTGATGTGG + Intergenic
1090992742 11:131834428-131834450 ATGTGGTAGGCACTGTGCTGGGG + Intronic
1091709123 12:2725070-2725092 ATGTGGAAGTCCATTTGAGTAGG - Intergenic
1093474965 12:19544569-19544591 ATGTGGAAAGTTCATTGATGAGG + Intronic
1093710721 12:22327349-22327371 TTGTGGAAGGATCTTTGATTTGG - Intronic
1094784762 12:33834898-33834920 ATGTGGAAGCTGCTTTGAGGTGG - Intergenic
1097028743 12:56076894-56076916 AAATGAAAGGCCCTTTAATGTGG + Intergenic
1097155472 12:57008911-57008933 ATGTGTAAGGCACTTACATGTGG - Intergenic
1097385961 12:58950359-58950381 ATAGGGAAGGCCATTAGATGGGG + Intergenic
1098616475 12:72530950-72530972 CTGTGTAAGGCACTTTGATAGGG - Intronic
1108557812 13:51612957-51612979 ATGTGAAAGACACTTTGGTGGGG + Intronic
1108932713 13:55848267-55848289 ATGTTGAAGGGCATTTGATTTGG - Intergenic
1109257611 13:60102187-60102209 ATGTGTAATGCCCTTTCTTGAGG - Intronic
1114615985 14:24068722-24068744 GTGGGGGAGGCACTTTGATGAGG + Intronic
1116375182 14:44190472-44190494 ATGTGGAACACACTTTGATTAGG - Intergenic
1120797997 14:88656635-88656657 ATATGCAAGGCCATTTTATGAGG - Intronic
1121420020 14:93806646-93806668 ATGTGGTAGGCACTTTTGTGGGG + Intergenic
1122927214 14:104910372-104910394 CTTTGGAATGCCCTTTGCTGAGG - Intergenic
1123165584 14:106322567-106322589 GTGTGAAAGGCCCTTTTGTGTGG - Intergenic
1123977056 15:25563587-25563609 GTGTGGAGGGCACTGTGATGTGG + Intergenic
1123979172 15:25583549-25583571 ATATGGAAGTCCCATTGATGCGG - Intergenic
1126743211 15:51799148-51799170 ATGGGGAAGGGTCTGTGATGGGG + Intronic
1127359349 15:58231056-58231078 ATGTGGAAGCCCCTTCTCTGTGG - Intronic
1127978747 15:64018503-64018525 ATGGGGGAGGCCATTTGTTGCGG - Intronic
1128425082 15:67535037-67535059 ATGTGCCAGGTCCTTAGATGAGG - Intergenic
1129229467 15:74188807-74188829 ATGAGGAAGGCCATGGGATGGGG - Intronic
1129726386 15:77903762-77903784 ATGTGGGAGGCCCTTTGTGCAGG + Intergenic
1132886020 16:2182375-2182397 ATGTGTGTGGCCCTGTGATGTGG - Intronic
1136272042 16:29154028-29154050 CTGGGAAAGGCTCTTTGATGAGG + Intergenic
1137581295 16:49635040-49635062 ATGTGGAAGGCCCTTTGATGTGG - Intronic
1139206205 16:65031383-65031405 ATGTGAAAAGTTCTTTGATGGGG + Intronic
1142075641 16:88116009-88116031 CTGGGAAAGGCTCTTTGATGAGG + Intronic
1143283706 17:5773519-5773541 ATGTGGAAGGCCTTGGGGTGGGG + Intronic
1144563941 17:16344442-16344464 ATGTGGAAAGCGCTCTGCTGAGG + Intronic
1146259766 17:31413671-31413693 ATGTGGAAGGGCCTTGGAGGAGG - Intronic
1149785523 17:59431480-59431502 ATGTGGAAGGCACTGTGCTCAGG - Intergenic
1152156639 17:78637986-78638008 ATGTTGATGGCCGGTTGATGGGG + Intergenic
1152253849 17:79226096-79226118 ATGTGGAATGCCCTTTGCCAGGG - Intronic
1156215449 18:34993510-34993532 AAGGGGAAGTCCCTTTGATTAGG - Intronic
1156576945 18:38328154-38328176 ATGAAAAAGGCCCTTAGATGGGG + Intergenic
1157800567 18:50617108-50617130 AGATGGAGGACCCTTTGATGAGG + Intronic
1158125303 18:54094165-54094187 AGGTGGAGGGCCATCTGATGAGG - Intergenic
1160045073 18:75379131-75379153 GAGTGGAAGGCCCCTTGCTGAGG - Intergenic
1165608410 19:37128008-37128030 ATGTGGAAGGGCCTTTATTCGGG + Exonic
1166272238 19:41721603-41721625 AGGAGGAAGCCCCTTGGATGAGG + Intronic
925852715 2:8098603-8098625 ATGAGGAACTCCCTTTGCTGTGG + Intergenic
927509829 2:23637430-23637452 ATGGGGCAGGCCCTCTGATAAGG + Intronic
927682863 2:25151663-25151685 ATGTGGGAGGCCCTTTCAGCGGG - Intronic
928284657 2:29979300-29979322 ATGTTTAAGTCCATTTGATGTGG - Intergenic
929323484 2:40576569-40576591 GTGTGAAAATCCCTTTGATGGGG + Intronic
930107614 2:47652461-47652483 ATGTGAAACCCACTTTGATGTGG + Intergenic
930752792 2:54948756-54948778 AAGTGGAGGGGCCTTTGAGGCGG + Intronic
931890831 2:66670240-66670262 ATGTGGAAGGCCCTGTGGACCGG - Intergenic
933391846 2:81679986-81680008 ATTTGCAATGCCTTTTGATGAGG + Intergenic
933983010 2:87568877-87568899 ATGTGTGATGCCATTTGATGTGG - Intergenic
934013219 2:87848764-87848786 TCGTTGAAAGCCCTTTGATGTGG - Intergenic
934770197 2:96902822-96902844 ATGGAGAAAGCCCTTTGCTGGGG - Intronic
936310834 2:111381918-111381940 ATGTGTGATGCCATTTGATGTGG + Intergenic
937977683 2:127591696-127591718 CTGGGGAACGCCCTCTGATGTGG - Intronic
938662280 2:133499474-133499496 ATGTGGTATGCCCGCTGATGAGG - Intronic
939507006 2:143057754-143057776 ATGTGGAAGGGACTTTGAACTGG - Intergenic
940211956 2:151264122-151264144 CTCTGGAAGGCCCATTGTTGGGG - Intergenic
941412072 2:165171111-165171133 TTGTGGAATGCCCTTTGAAATGG - Intronic
945046581 2:205787226-205787248 ATGTGGAGGGCCCTAGGCTGGGG - Intronic
948836528 2:240628710-240628732 AGGAGGAAGGCCCTTCGCTGTGG + Intronic
1170121215 20:12914487-12914509 ATACAGAAGGCACTTTGATGAGG - Intergenic
1174174911 20:48638508-48638530 ATGTGGAAGGGCTTTGGATTTGG + Intronic
949905458 3:8854929-8854951 CTGTGGAAGGCCTTTTGTGGAGG + Intronic
950231643 3:11281215-11281237 AAATGGAACCCCCTTTGATGTGG - Intronic
950437739 3:12990868-12990890 ATGTGAAAGCCCCTGTGATCAGG + Intronic
955540508 3:59971353-59971375 GTGTGGAAGGCCTTATAATGAGG + Intronic
959521823 3:107330166-107330188 ATGGTCAAGGTCCTTTGATGTGG + Intergenic
960712359 3:120544366-120544388 ATGGGGTAGTCCCCTTGATGTGG + Intergenic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
964499231 3:157330428-157330450 ATGTGGAAGGCCCTCTCCTGGGG - Intronic
965719606 3:171647173-171647195 ATGTGCAAGGGTCTTTGATTGGG - Intronic
966669006 3:182506102-182506124 ATGTGAAAGGCTCTGTGGTGGGG - Intergenic
971347098 4:25821478-25821500 ATGTGGAAGGCACTGTGCAGAGG + Intronic
971879807 4:32356866-32356888 ATTTGGAAGGACCTATGATCTGG - Intergenic
972349165 4:38220415-38220437 ATGGGAAAGGCCCTTTGATATGG - Intergenic
973529242 4:51818808-51818830 ATGTTGAAGCCCCTTTAATGAGG + Intergenic
976285712 4:83369338-83369360 ATGATGAAGGCCGTTGGATGTGG - Intergenic
979988950 4:127351224-127351246 ATGAGGAAGTCCTTTAGATGAGG - Intergenic
984052200 4:174878009-174878031 ATGTGGGAGGCCCTATGGAGGGG + Intronic
985534511 5:456508-456530 ATGTGGAAGAGCCTTTCCTGTGG - Intronic
985829183 5:2215402-2215424 ATCTGGACGCCCCATTGATGAGG - Intergenic
987679939 5:21122044-21122066 ACAAGGAAGGGCCTTTGATGTGG + Intergenic
990086049 5:51979119-51979141 ATGTGTCAGGCACTATGATGAGG - Intergenic
990298276 5:54425237-54425259 AAGGGGAAGCCCCTTTGCTGGGG - Intergenic
992206634 5:74436662-74436684 ATGTGGAAGGCCTCTTCAAGGGG + Intergenic
994599279 5:101881677-101881699 ATGTGGAAGGCCATGTGCTGTGG + Intergenic
994637794 5:102364196-102364218 ATGTGGAAGGGCCTTTGAGCTGG - Intergenic
1001490554 5:172151781-172151803 AAGTGGAAGGCCCCATGGTGGGG - Intronic
1002399575 5:178984076-178984098 ATTTGGAAGGTCCTTTGTTCAGG - Intronic
1002819055 6:706833-706855 AAGTGGGAGGCCCTTTGAGCAGG - Intergenic
1003067759 6:2918148-2918170 ATATGGATGGCCGTCTGATGTGG + Intergenic
1004022916 6:11790686-11790708 ATTTGAAAGGTCCTTTGATAAGG - Intronic
1004037231 6:11935339-11935361 ATGTGAAAGTTCCTTTGAGGTGG - Intergenic
1004619365 6:17319845-17319867 ATCTGAAAGGCCTTTTGATAAGG + Intergenic
1005245463 6:23879236-23879258 ATGTGGAAGACCTGATGATGTGG - Intergenic
1005750767 6:28880395-28880417 ATGAGGAAGGGACATTGATGAGG - Intergenic
1007200121 6:40100326-40100348 TTTTGCAAGGCCCTTTCATGAGG + Intergenic
1008706666 6:54168997-54169019 ATTTGGAAGTCCCAATGATGTGG + Intronic
1011125891 6:84007223-84007245 ATGTGGAAGTCACTGTGATGTGG + Intergenic
1012986852 6:105884786-105884808 ATGTGGCAGGCACTTTGAGGAGG - Intergenic
1013299936 6:108795314-108795336 ATCAGGAAGGCCCTATGAGGTGG - Intergenic
1013647041 6:112155190-112155212 ATGTGGCAAGCACTTTGGTGGGG - Intronic
1015266310 6:131295214-131295236 ATGGGGAATGCGCTCTGATGTGG + Intergenic
1018101799 6:160446866-160446888 TGGTGGAAGCCCCATTGATGGGG + Intronic
1018777522 6:167031253-167031275 ATGTGAAAGGCCCTGAGGTGGGG - Intronic
1019121300 6:169806893-169806915 ATGTGGAGAGCTCTGTGATGTGG - Intergenic
1026256744 7:68718795-68718817 ATGTGCCAGGCCCTATGTTGAGG - Intergenic
1030653058 7:112136505-112136527 ATGTGTCAAGCCCTTTGCTGGGG + Intronic
1031060633 7:117047446-117047468 GTCTGGAGGGCCCTTTGATATGG + Intronic
1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG + Intergenic
1033900264 7:146130019-146130041 GTTTGGAAGTCACTTTGATGAGG + Intronic
1036052778 8:5218546-5218568 ATGTGGAAGGCATTTGGAGGTGG - Intergenic
1036149927 8:6287818-6287840 ATCTGAAAGCTCCTTTGATGAGG - Intergenic
1036643802 8:10599969-10599991 TTGTGGAACGAGCTTTGATGCGG - Intergenic
1038358581 8:26854785-26854807 ATCTGAAAGGCCCTGTGCTGTGG + Intronic
1038711188 8:29947543-29947565 CTGTGGAAGACCCTGTGAGGGGG - Intergenic
1040557926 8:48497409-48497431 ATGAGGAAGGACCTTTGAAGAGG - Intergenic
1041390459 8:57343122-57343144 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1044576879 8:93779542-93779564 ATGTGGATGGGGTTTTGATGTGG + Intronic
1047807505 8:128375598-128375620 ATATGGAAGGGCCTTTGGTATGG + Intergenic
1047899979 8:129410030-129410052 ATTGGGAATGCCCTTTTATGAGG - Intergenic
1048869824 8:138788054-138788076 ATTTGGTAGGCCCTTTAGTGGGG + Intronic
1049627934 8:143634621-143634643 CTGTAGAAGGTCCTTGGATGAGG + Intergenic
1050684768 9:8155574-8155596 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1052234025 9:26188736-26188758 ATGTGGCAGGCCCAGTGCTGGGG - Intergenic
1053584297 9:39440347-39440369 ATCTGGAAGTCCCTATAATGGGG + Intergenic
1054105877 9:60999093-60999115 ATCTGGAAGTCCCTATAATGGGG + Intergenic
1055767044 9:79674507-79674529 ACGTGGCAGGCCCCTTGCTGGGG - Intronic
1056206324 9:84322940-84322962 CTTTGGAAAGTCCTTTGATGAGG + Intronic
1058121323 9:101142449-101142471 ATTTGGATGGCCCTTTCATCAGG + Intronic
1058745110 9:107982829-107982851 ATGTGGAAAGCCATTCCATGAGG + Intergenic
1061383691 9:130275978-130276000 GCCTGGAAAGCCCTTTGATGAGG - Intergenic
1061496941 9:130980501-130980523 ATGTGCACGGCCCTATGCTGAGG - Intergenic
1062405385 9:136393759-136393781 ATGGGGAAGCCCCCTTCATGGGG + Intronic
1186756592 X:12678216-12678238 ATGTGAAAGGCCCAGTGATGGGG - Intronic
1187924628 X:24238574-24238596 ATGTGGCAGGCTCCTTGAGGTGG + Intergenic
1190991406 X:55554583-55554605 ATGTGGTAGGGCCTTTAAGGAGG - Intergenic
1195446651 X:104959701-104959723 AGGGGTAAGGCCCTTTGCTGTGG - Intronic
1197135998 X:123060108-123060130 ATTTGGAAGGCACATTGGTGTGG - Intergenic
1198380943 X:136082840-136082862 TTGGGGAAGGCACTTTGAGGGGG - Intergenic
1199131251 X:144189715-144189737 TCGTTGAAAGCCCTTTGATGTGG + Intergenic
1199148607 X:144401643-144401665 ATGTTGAGGACCCTTTCATGTGG - Intergenic
1199802815 X:151268309-151268331 GTCTGGAAGGCCCTTGGATTTGG - Intergenic