ID: 1137581864

View in Genome Browser
Species Human (GRCh38)
Location 16:49638509-49638531
Sequence TCTTCAGGTGGATCTTGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137581855_1137581864 23 Left 1137581855 16:49638463-49638485 CCGCGCTTGCACACAGTGCACTT 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1137581864 16:49638509-49638531 TCTTCAGGTGGATCTTGAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137581864 Original CRISPR TCTTCAGGTGGATCTTGAGG TGG Exonic
900746754 1:4365948-4365970 TCTGGAGGTGGGTCTTGGGGAGG + Intergenic
901974250 1:12931919-12931941 TTTTCAGGTGGCCCTGGAGGGGG - Intronic
902010925 1:13269849-13269871 TTTTCAGGTGGCCCTGGAGGGGG + Intergenic
903281969 1:22255236-22255258 TCTGCAGGTGGAATTTGAGCAGG - Intergenic
903399521 1:23030580-23030602 TCCTCAGGTGGGGCTTGAGGGGG - Exonic
907832573 1:58079088-58079110 TCTTTTTTTGGATCTTGAGGAGG - Intronic
908463767 1:64371328-64371350 TCTTCAGGTGCATTTCCAGGGGG - Intergenic
910498544 1:87861775-87861797 TCTTCAGGTGTAAATTGAGGAGG + Intergenic
912393738 1:109323329-109323351 TCCTCAGATGGATGTTGAGATGG - Intronic
914372528 1:147041485-147041507 TCTGCAGGTGGAACTGGAGGGGG - Intergenic
914576975 1:148981288-148981310 TCTGCAGGTGGAACTGGAAGGGG + Exonic
915759099 1:158292774-158292796 TCTTCAGGTGATCCTGGAGGTGG + Exonic
916599296 1:166276528-166276550 TCTTCATCTGGATCTACAGGTGG + Intergenic
916880206 1:169013305-169013327 TCTTCAGGTGGCACCTAAGGTGG + Intergenic
919435379 1:197553021-197553043 ACTTCAGGTGGCTTTTGTGGAGG - Exonic
1063551614 10:7039290-7039312 TCATCATGTGAATTTTGAGGGGG - Intergenic
1066048848 10:31617610-31617632 TCTGCAGGTGGGCCCTGAGGTGG + Intergenic
1066368441 10:34798921-34798943 TCTTCAGGAAGCTCTTCAGGTGG - Intronic
1066453605 10:35553367-35553389 TCATCATGTGGATCTTGAACAGG + Intronic
1067736261 10:48853472-48853494 TCTCCAGATGGTTCTTGAGTGGG + Intronic
1067806543 10:49396962-49396984 TCTTCTGATGCATCTTGAGTGGG - Intergenic
1068601572 10:58962662-58962684 TTTTCAGCTGGACCCTGAGGTGG - Intergenic
1068643275 10:59435714-59435736 TATTGAGGTTGATATTGAGGAGG - Intergenic
1069126035 10:64635216-64635238 ACTTCAGATGGTTTTTGAGGGGG - Intergenic
1071240324 10:83698142-83698164 TCCTCAGGGTGATCTTAAGGTGG - Intergenic
1073082905 10:100871209-100871231 TGGTCAGATGGATCCTGAGGGGG - Intergenic
1073602686 10:104862107-104862129 TCAACAGGTGAATTTTGAGGGGG + Intronic
1073871124 10:107865561-107865583 TCTTGAGGTGGATATTGGGAGGG + Intergenic
1075118833 10:119649811-119649833 TCTTCACGTGGAGGCTGAGGAGG + Intergenic
1076559169 10:131349935-131349957 TCTTGAGGTGGCCTTTGAGGTGG + Intergenic
1076605184 10:131684763-131684785 TCTGCATGTGGATCTGGTGGGGG - Intergenic
1077083668 11:736543-736565 GCTTCAGGTGAGTCTTCAGGAGG + Intergenic
1077727777 11:4692820-4692842 TCTTCCGGTGATCCTTGAGGTGG - Intronic
1078188340 11:9071390-9071412 ACTTCAGGTGTAGCTTGATGTGG - Intronic
1079008591 11:16810277-16810299 CCTTCATCTGGATCTTGAAGTGG + Intronic
1079366794 11:19816867-19816889 TCTTCAGGTGAAACCAGAGGAGG + Intronic
1080462865 11:32471071-32471093 TCATCAGGTGGATCATTATGTGG + Intergenic
1082550139 11:54386096-54386118 TCTTCAGGTGGACATTGGGAGGG + Intergenic
1082553114 11:54525570-54525592 TCTTCAGGTGGACATTGGGAGGG + Intergenic
1084477648 11:69398163-69398185 TCTTGAGAGGGATCTTGAGGAGG - Intergenic
1086073264 11:82822209-82822231 TCTTGGGGTGGATCTTGGGAAGG - Intergenic
1086405282 11:86494172-86494194 TCTTCAAGTGGGTCTGGAGGGGG + Intronic
1086853303 11:91837161-91837183 CCTTAAGGTGGATATTAAGGTGG + Intergenic
1088314630 11:108495465-108495487 TATTCAGTTGGTTCTTGAAGAGG + Intronic
1089160828 11:116435803-116435825 TCATCAGGTGGGTCTTGCAGGGG - Intergenic
1089196141 11:116694974-116694996 TCTGGAGGTGGCTCCTGAGGAGG - Intergenic
1090253328 11:125265807-125265829 TCATCAGGAGGATCCTGAAGGGG + Intronic
1094049762 12:26206090-26206112 GCTTCAGGGAGGTCTTGAGGTGG - Intronic
1094149389 12:27265952-27265974 TCTTCAGAGGGCTCTTGAGAGGG - Intronic
1095592223 12:43916101-43916123 TCTTCTGGTGGATTTGAAGGTGG - Intronic
1096589047 12:52645125-52645147 TCTGGAGGTGGCTCTAGAGGAGG - Exonic
1097320682 12:58222667-58222689 TCTTAAGGTTGAGCTTCAGGGGG - Intergenic
1098764369 12:74467991-74468013 TCTTCAGGTAGATCTTCTTGTGG + Intergenic
1098876495 12:75871475-75871497 TATTCAAGTGGATGTTGAGAAGG - Intergenic
1099677024 12:85773880-85773902 TCTTCAGAGGGACCTTGAGAGGG + Intergenic
1100852066 12:98722636-98722658 TTTTCATGTGGAGCTTCAGGAGG - Intronic
1104637420 12:130447001-130447023 TTTTCAGGGGGATCTGCAGGGGG + Intronic
1105548010 13:21365855-21365877 TCTGCAGGTGGCTCCTGGGGCGG - Intergenic
1112405697 13:99118334-99118356 TCTTCATGTGTTTCTTGAGCAGG + Intergenic
1112807969 13:103183854-103183876 TCACCGGGTGGATCTTTAGGGGG - Intergenic
1113567781 13:111329087-111329109 GCTTCACGTGGACCTTGATGAGG - Intronic
1115903539 14:38181730-38181752 TCTTCAAGACAATCTTGAGGTGG - Intergenic
1115909713 14:38241932-38241954 TCTACAGCTGTAACTTGAGGAGG - Intergenic
1116496154 14:45563179-45563201 TTTTCAGGTGGGTCTTGTGGTGG + Intergenic
1118115827 14:62775886-62775908 TCAACAGATGGATTTTGAGGGGG - Intronic
1119381142 14:74229346-74229368 TCTTCAGGTGGATCTTCAAAAGG + Intergenic
1120306231 14:82773866-82773888 TCTTCAGGTGAACCTAAAGGTGG + Intergenic
1123149005 14:106163602-106163624 TCTGAATGTGGATCTGGAGGTGG + Intergenic
1126440275 15:48680798-48680820 GCCTCAGGCGGATCTTCAGGAGG - Intergenic
1130708589 15:86256997-86257019 CCTTCAGGTAGATCATGTGGAGG - Exonic
1131643367 15:94315582-94315604 CCTTCAGGTGTATGGTGAGGAGG - Exonic
1131942589 15:97583923-97583945 TCTTCAGGTTGATCTTCTCGTGG + Intergenic
1133644570 16:7752136-7752158 TATTCAGATGGATCTTCAGGAGG - Intergenic
1137581864 16:49638509-49638531 TCTTCAGGTGGATCTTGAGGTGG + Exonic
1138615314 16:58160722-58160744 TCTAAAGGTAGCTCTTGAGGAGG - Intronic
1140688574 16:77458253-77458275 TGTGAAGGTGCATCTTGAGGAGG + Intergenic
1140940511 16:79717648-79717670 TCTACACATGGATCTAGAGGGGG - Intergenic
1142388832 16:89784760-89784782 TCTGCAGGAGGCTCTTGGGGAGG + Intronic
1143172082 17:4936172-4936194 TCTTCAGGACCATCTGGAGGGGG - Intergenic
1144827995 17:18117203-18117225 GCTCCAGGTGAATCTTGGGGAGG + Intronic
1144885245 17:18453946-18453968 TCTGCAGTTGGATTGTGAGGTGG - Intergenic
1145177041 17:20709523-20709545 TCTGCAGTTGGATTGTGAGGTGG + Intergenic
1147660780 17:42115800-42115822 CCTTCAGGTGGTTCATCAGGTGG + Exonic
1149313240 17:55416615-55416637 TCTTCAGGAGGCTGTGGAGGAGG - Intronic
1150265266 17:63828131-63828153 TCTTCAGATGGAGCTGGAGGAGG + Exonic
1155141308 18:23047054-23047076 TCTTCAGTTGGATTTTGGGGTGG + Intergenic
1155590280 18:27419759-27419781 TCCTCTGGTGGATCTAGATGAGG + Intergenic
1159678888 18:71321802-71321824 TCTTCAGCTGTATGATGAGGAGG + Intergenic
1160682963 19:420368-420390 TCCTCAGGTGGCTCTTGGGCTGG - Intronic
1162336282 19:10062425-10062447 TCTTGAGGTATGTCTTGAGGAGG - Intergenic
1163585277 19:18160526-18160548 TCTTCTGGTGAAGCTTGTGGAGG + Exonic
1167424970 19:49425538-49425560 TGTTCAGGTGGAGGTGGAGGCGG - Intronic
1168617626 19:57851190-57851212 TCTTCAGGAGCAACTTGGGGAGG + Intronic
1168625630 19:57915812-57915834 TCTTCAGGAGCAACTTGGGGAGG - Intronic
926173974 2:10572536-10572558 TCTTAAGGTGGCTCTTGTGTAGG - Intronic
927391845 2:22604965-22604987 GCTTCAGTTGGACCTTGATGAGG - Intergenic
933653736 2:84870509-84870531 ACTCCAGGTGGCGCTTGAGGCGG + Exonic
936953007 2:117997217-117997239 TCTGCAGGTGGATCTTCTGCAGG - Intronic
938070492 2:128305785-128305807 CATTCAGCTGGACCTTGAGGAGG + Intronic
940531072 2:154876914-154876936 ATTTCAGCTGGGTCTTGAGGAGG + Intergenic
942114757 2:172717271-172717293 GCTCCAGATGGATCTTGAGATGG + Intergenic
946578553 2:221102771-221102793 TCTTCTGGTGAATCTCCAGGGGG + Intergenic
947426253 2:229985573-229985595 TCTGCAAGTGGATGGTGAGGTGG + Intronic
1171124400 20:22588740-22588762 TTTTCCTGTGGATCTTGCGGTGG - Intergenic
1171344641 20:24456790-24456812 TCTTCAGCCTGATCTTGAAGAGG + Intergenic
1171744430 20:28952780-28952802 TCTTCAAGTGGATATTTGGGGGG + Intergenic
1172477869 20:35252532-35252554 CCATCAGGTGGATTTTGGGGTGG - Intronic
1173166187 20:40688754-40688776 TCTTCACGTCGAACTTGAGCAGG + Exonic
1173231548 20:41202726-41202748 TCTTCAGGTTGATTTTAATGGGG + Exonic
1173293916 20:41739030-41739052 TCTGCTGGTGGTTCTTGGGGAGG - Intergenic
1176318252 21:5273894-5273916 TCTTCAAGTGGATATTTGGGGGG - Intergenic
1176476115 21:7210671-7210693 TCTTCAAGTGGATATTTGGGGGG - Intergenic
1179275847 21:39891095-39891117 TATTCACGTGGAACTTGATGTGG + Intronic
1182292544 22:29292490-29292512 TCTTCATCTGGATCTACAGGTGG - Exonic
1183158202 22:36091916-36091938 TGCTCAGATGGATTTTGAGGGGG - Intergenic
1183545504 22:38453036-38453058 TCTTAATGTGGATCTGGGGGAGG - Intronic
1184903481 22:47463061-47463083 TGCTCAGGTGCATCTGGAGGTGG - Intronic
1185265901 22:49903879-49903901 TCTGCAGGTGGACGTTGAAGGGG + Exonic
949314903 3:2742116-2742138 TCTTCAGGCTGAATTTGAGGGGG + Intronic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
953376328 3:42431446-42431468 CCTTCAGGTAGATCTGGAGCTGG - Intergenic
954584480 3:51721349-51721371 TTTTCTGCTGGAACTTGAGGCGG - Intergenic
954913337 3:54127543-54127565 TCTTCAGATTGCTCTTGTGGGGG + Intronic
955432886 3:58867885-58867907 TCTGCTGATGGTTCTTGAGGGGG + Exonic
962487033 3:135853726-135853748 TCCTTAGGAAGATCTTGAGGAGG + Intergenic
963071621 3:141309674-141309696 TCTTCAAGTGGCTCAAGAGGGGG - Intergenic
965930429 3:174036305-174036327 TCTTCAGGTGATTCTTATGGAGG + Intronic
966819392 3:183913233-183913255 TCTTCAGCAGTATTTTGAGGAGG - Intergenic
967332268 3:188302642-188302664 TCATAAGGTGCATCTTGTGGAGG - Intronic
969347881 4:6580585-6580607 TTCTCAGCTGCATCTTGAGGAGG - Intronic
969725268 4:8914789-8914811 TCCTCAGGTGCAGCTTCAGGGGG + Intergenic
970198512 4:13576852-13576874 TCTGGTGGTGGATCTTGTGGTGG + Exonic
974986474 4:69033576-69033598 TTTTCAGGTGATTCTTTAGGTGG - Intronic
974991821 4:69102033-69102055 TTTTCAGGTGATTCTTTAGGTGG - Intronic
981531861 4:145761528-145761550 TCTTGTAGTGGGTCTTGAGGTGG + Exonic
986140827 5:5027892-5027914 TCTTGGGGTTGATCTTGTGGTGG - Intergenic
988331630 5:29849272-29849294 CCTTCAGTTGAATCTTAAGGAGG + Intergenic
990069539 5:51763693-51763715 TCAACAGGTGGCTTTTGAGGAGG - Intergenic
995181365 5:109233809-109233831 TCTTCAGGTGGGACCTGATGTGG + Intergenic
995181964 5:109237904-109237926 TGTTCTGGTGGATCTTGGAGAGG + Intergenic
995194127 5:109344774-109344796 TCTTGCAGTGGATGTTGAGGTGG - Exonic
996782895 5:127207731-127207753 TCATCAGGTGGAACCTGAGCGGG + Intergenic
997204125 5:132031642-132031664 TTCTCAGGTGGAGCTAGAGGTGG + Intergenic
999044412 5:148451609-148451631 TATTCAGGTACAGCTTGAGGTGG - Intronic
1000999804 5:167994923-167994945 TCTGCAGGTGGCTGTTCAGGGGG + Intronic
1002719051 5:181246876-181246898 CCTTCAGGTGCAGCTTGAGGGGG + Intronic
1005232073 6:23713650-23713672 ACTTCAGGTGGATGCTGAGCAGG - Intergenic
1006429354 6:33985564-33985586 TCTTCAGCTGAAGCATGAGGGGG - Intergenic
1007045024 6:38764539-38764561 TCTTCAGGTACATCTGAAGGAGG - Intronic
1007154756 6:39731756-39731778 TCTTCAGGGGGAGCTCCAGGGGG - Intergenic
1008322759 6:50137401-50137423 TCTACAGGTGGATGTTTAGGGGG - Intergenic
1009345885 6:62612487-62612509 TTTTCTAGTGGCTCTTGAGGAGG - Intergenic
1010257415 6:73774882-73774904 TCTCCAGTTGGTTCTGGAGGAGG + Intronic
1011018579 6:82785931-82785953 TTCTCAGGTAGATTTTGAGGTGG - Intergenic
1011792465 6:90913429-90913451 TCATCAGGGGGATGGTGAGGAGG - Intergenic
1015479008 6:133687382-133687404 TTATCAGTTGGATCTTCAGGTGG + Intergenic
1015913106 6:138187786-138187808 ACATCAGGTGGATGCTGAGGTGG - Intronic
1017377801 6:153790952-153790974 TCTGCTGCTGGATCTTGGGGAGG - Intergenic
1018664616 6:166123945-166123967 TCTTCAAGAGGATGTTCAGGAGG - Intergenic
1022299335 7:29088385-29088407 TCCTCAAGTGGAACTTGAGCTGG - Intronic
1022817075 7:33924028-33924050 TCTCCACGTGGATGTTGAGCAGG + Intronic
1024171991 7:46798350-46798372 TCTTCAGGTTGTTCATGTGGTGG + Intergenic
1029736050 7:102466338-102466360 ACATCAGGAGGATGTTGAGGAGG + Intronic
1030013720 7:105197481-105197503 TGTTCAGGTGGATCTGGGGAAGG - Intronic
1031770239 7:125832778-125832800 TATTCTGGTCGATCTTTAGGAGG + Intergenic
1034200760 7:149281776-149281798 TCGTCAGATTGATCTTCAGGCGG - Exonic
1037901198 8:22690565-22690587 GCTTGAGGTGGATCTTGGCGTGG + Exonic
1041876862 8:62698399-62698421 TCTGCAGGAGGAGCTTGAGTAGG - Intronic
1042067934 8:64899522-64899544 GCTGTGGGTGGATCTTGAGGGGG - Intergenic
1043318016 8:78945077-78945099 TATTTAGGTGGAACTTGAGCTGG + Intergenic
1043426997 8:80157474-80157496 TCTTCAGGTCATTGTTGAGGGGG - Intronic
1044841278 8:96339020-96339042 TCTTCAGGTGGCTCCAGGGGTGG + Intergenic
1047781209 8:128112713-128112735 TTTACCTGTGGATCTTGAGGAGG - Intergenic
1048303117 8:133265863-133265885 ACTTCTGGTTGACCTTGAGGAGG - Intronic
1049483416 8:142838922-142838944 TTTCCAGCTGGATCTTGGGGTGG - Intronic
1051653702 9:19356444-19356466 TCTTTGGGTGGGACTTGAGGAGG - Intronic
1057935307 9:99233512-99233534 TCTTCAGTGGGATCTTCAGCTGG + Intergenic
1060285880 9:122251945-122251967 ACTTCTGGAGGAGCTTGAGGAGG + Exonic
1060340306 9:122769267-122769289 TCTTCAGGTTGATCTTCTTGTGG - Intergenic
1203411547 Un_KI270579v1:13357-13379 TCTTCAAGTGGATATTTGGGGGG - Intergenic
1188045847 X:25425830-25425852 TGTTCTGGTGGAGGTTGAGGGGG + Intergenic
1188460395 X:30419411-30419433 TCTTCAGGTATATCTTTATGGGG - Intergenic
1188528310 X:31109730-31109752 TCTTCAGTTGCATTTTGAGTTGG + Intronic
1190435159 X:50417206-50417228 ACATCAGCTGGCTCTTGAGGTGG - Intronic
1191256397 X:58281423-58281445 TTTTCAGGGGGAGGTTGAGGAGG - Intergenic
1191715465 X:64191017-64191039 TCTTCCTCTGGATCTTCAGGGGG + Exonic
1193137115 X:77984438-77984460 TCTTCAAGTGGTTCTTCAAGTGG + Intronic
1193888434 X:87012438-87012460 TCTTAAGGTGAATCATTAGGTGG - Intergenic
1196284342 X:113862539-113862561 TCTTCGGGTTGATCTTCATGTGG + Intergenic
1196967619 X:121075958-121075980 TTTTCAGCTGCATCTTGAGGAGG - Intergenic
1200831038 Y:7689194-7689216 TGTTCAGGTGGAGCTGGAGCCGG - Intergenic