ID: 1137582751

View in Genome Browser
Species Human (GRCh38)
Location 16:49643935-49643957
Sequence CTTGGTGACCAGCATGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137582748_1137582751 -4 Left 1137582748 16:49643916-49643938 CCAAGCTCATGTGGTCACACTTG 0: 1
1: 0
2: 0
3: 17
4: 153
Right 1137582751 16:49643935-49643957 CTTGGTGACCAGCATGGAGCAGG 0: 1
1: 0
2: 2
3: 24
4: 243
1137582747_1137582751 -3 Left 1137582747 16:49643915-49643937 CCCAAGCTCATGTGGTCACACTT 0: 1
1: 0
2: 0
3: 77
4: 1996
Right 1137582751 16:49643935-49643957 CTTGGTGACCAGCATGGAGCAGG 0: 1
1: 0
2: 2
3: 24
4: 243
1137582745_1137582751 7 Left 1137582745 16:49643905-49643927 CCAGGTGATTCCCAAGCTCATGT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1137582751 16:49643935-49643957 CTTGGTGACCAGCATGGAGCAGG 0: 1
1: 0
2: 2
3: 24
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137582751 Original CRISPR CTTGGTGACCAGCATGGAGC AGG Intronic
900265879 1:1756967-1756989 CTGGGTGACCAACAATGAGCTGG - Intronic
900612734 1:3551202-3551224 CTTTGTCACCTGCATGGGGCGGG - Intronic
900659228 1:3774564-3774586 GTTGGAGCCCAGCAGGGAGCTGG + Intronic
900707475 1:4089652-4089674 CCTGGTGGGCAGCATGGAGCCGG + Intergenic
902211279 1:14906416-14906438 CTTGGTGGCGGGCATGGAACAGG + Intronic
902220182 1:14959547-14959569 CCCGGTGACCAGCATGCGGCTGG + Intronic
904008088 1:27374221-27374243 CCGGGTGCCCAGCCTGGAGCTGG + Intronic
904622453 1:31783558-31783580 CCTGGTACCCAGCATGGAGCTGG + Intergenic
904680226 1:32223893-32223915 CTTGGGAAACAGCAGGGAGCTGG - Intronic
905384710 1:37594341-37594363 CATGGTGCCTTGCATGGAGCAGG - Intronic
908269224 1:62406833-62406855 CTTGGGGACCAACATGGAGCAGG + Intergenic
908351046 1:63286527-63286549 CTTGGGGACTGGCATGGAGCTGG - Intergenic
909684676 1:78334040-78334062 CTTTGAGTCCAGCATGGACCAGG + Intronic
910647396 1:89528261-89528283 CTCAGTCACCTGCATGGAGCTGG - Intronic
912529909 1:110312764-110312786 CCTGGTGACCAGCAGAGGGCAGG - Intergenic
913512245 1:119572550-119572572 CTAGGAGAGTAGCATGGAGCTGG + Intergenic
913516524 1:119610059-119610081 CTAGGAGAGTAGCATGGAGCTGG + Intergenic
914346945 1:146808073-146808095 CTGGGTGTCCAGCAGGGAGTTGG - Intergenic
916094799 1:161339708-161339730 CTTGTTGCCCAGACTGGAGCTGG + Intronic
916097823 1:161366660-161366682 TGTGCTGTCCAGCATGGAGCCGG + Exonic
920102031 1:203522667-203522689 CTTCCTGAGCAGCATGGGGCTGG + Intergenic
920170598 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG + Intergenic
920276797 1:204812185-204812207 CATGGTGACCAACAAGGACCTGG + Intergenic
922029455 1:221783925-221783947 AGTGGTGAACAGCATGGGGCAGG + Intergenic
922742012 1:228019256-228019278 CACTATGACCAGCATGGAGCCGG - Intronic
923055386 1:230422852-230422874 CTTGGTGCCCAGCTGGGAGAGGG - Intronic
924625437 1:245693368-245693390 CTTGGTGCCCAGCACTGGGCTGG + Intronic
1062787443 10:277474-277496 CTTGGTGACCAACGTGGTCCTGG - Exonic
1064261201 10:13787950-13787972 CTTAACTACCAGCATGGAGCAGG + Intronic
1065765317 10:29024537-29024559 CTGGAGGACCAGCATGGAACTGG + Intergenic
1067062505 10:43085085-43085107 TCTGGAGGCCAGCATGGAGCTGG + Intronic
1067289619 10:44931687-44931709 CCTGGTGACCAGCAGGTAGAAGG + Intronic
1069226148 10:65947465-65947487 CCTAGTGTCCAGCATGTAGCAGG - Intronic
1072730612 10:97843623-97843645 CTCCGTGCCAAGCATGGAGCTGG - Intergenic
1073805935 10:107097686-107097708 TTTGGTGACCAGAATCGAGAGGG - Intronic
1074191252 10:111139560-111139582 CCAGGTCACCAGCGTGGAGCCGG + Intergenic
1075103835 10:119524224-119524246 CTTGGTGCCCAGCACTGAACAGG - Intronic
1075665116 10:124224372-124224394 CTTCGAGTTCAGCATGGAGCCGG + Intergenic
1075747377 10:124737122-124737144 CTGGGTGTCCAGTGTGGAGCCGG - Intronic
1076713796 10:132353214-132353236 CTTTGTGAGCTGCCTGGAGCTGG + Intronic
1076991968 11:280147-280169 CTTGGTGATCTTCACGGAGCGGG - Exonic
1077181573 11:1219419-1219441 CCAGGTGTCCAGCGTGGAGCTGG + Intergenic
1077300004 11:1842390-1842412 GCTGGGGACCAGCATGGTGCTGG + Intergenic
1077562647 11:3273612-3273634 CTTGGTGACTCCCATGGAGGAGG - Intergenic
1077568540 11:3319431-3319453 CTTGGTGACTCCCATGGAGGAGG - Intergenic
1078725942 11:13931131-13931153 GTTGGTCACCAGCATTGTGCAGG - Intergenic
1079084989 11:17438946-17438968 CTAGGCGGCAAGCATGGAGCTGG + Intronic
1079378645 11:19917262-19917284 CTTGGAAACCAGCAAGGAGGTGG - Intronic
1079477256 11:20844200-20844222 CATGGTGACCAACATGGGGAAGG + Intronic
1080408275 11:31999577-31999599 CTGGGTCACCAGCATGGGCCAGG - Intronic
1081674922 11:44963203-44963225 CTTGGGGCCCAGCAGGAAGCTGG - Intergenic
1081801272 11:45860941-45860963 CTTGGTGACCAGCCAGCAGATGG + Exonic
1083742699 11:64719514-64719536 CATGGAGAGAAGCATGGAGCGGG + Intronic
1083805101 11:65068557-65068579 CTTGTTGGCCAGCTTGGAGTGGG + Intronic
1084077394 11:66790894-66790916 CTTAGTGACCAGCAGTCAGCTGG + Intronic
1084169620 11:67394437-67394459 AGCAGTGACCAGCATGGAGCAGG - Intronic
1085250616 11:75141236-75141258 TTGGCTGACCAGCATCGAGCAGG - Intronic
1085337359 11:75706388-75706410 CTTGGTGCCCAGCGTGGGGCGGG - Intergenic
1087485838 11:98758877-98758899 TTTGGTGCCCAACATGGGGCTGG + Intergenic
1089260020 11:117217922-117217944 CATGGTGGCCAGCATGAACCAGG - Intronic
1089904028 11:122019200-122019222 CTTGCTGTCCAGCAATGAGCAGG - Intergenic
1090270032 11:125379583-125379605 CTTGGAGAGCATCATGGGGCAGG - Intronic
1090434126 11:126672678-126672700 CTTGGTTCCCAGCATGGAGCTGG + Intronic
1091557588 12:1586560-1586582 GAAGGTGACCAGCATGGAGGCGG - Intronic
1096072246 12:48781891-48781913 CCTGGTGCCCAGCATGGGGAAGG + Intronic
1097104681 12:56615029-56615051 CTTGGTAGGCAGCTTGGAGCTGG - Exonic
1100467024 12:94855412-94855434 CTTTGTGACTAGCATATAGCTGG - Intergenic
1103853083 12:123946136-123946158 CGTGGAGAGCAGAATGGAGCAGG - Intronic
1104558306 12:129821954-129821976 CATGGTGCCCAGCATACAGCAGG - Intronic
1104997058 12:132664651-132664673 CTTGGTGCCCAGGAAGGATCTGG + Intronic
1105308436 13:19185454-19185476 CCTGGTGTCCTGCATGCAGCAGG - Intronic
1106304416 13:28496613-28496635 CTGGGGGACCAGCAAGGAGAAGG - Intergenic
1106405824 13:29471922-29471944 CCTGGTGACCAAAAGGGAGCTGG - Intronic
1110332522 13:74288876-74288898 CTTGTTGACCAGTGGGGAGCAGG - Intergenic
1110794854 13:79624328-79624350 CATGGTGAACATCATGGGGCAGG + Intergenic
1111896687 13:94150705-94150727 CTTTGGGACCAGCATGGATTAGG + Intronic
1113244125 13:108376328-108376350 CTTGCTGAGCTGCCTGGAGCTGG + Intergenic
1113392428 13:109910269-109910291 CTTGGAGAAGAGCATGGAGCAGG - Intergenic
1113930955 13:113968639-113968661 CTTGGAGGCCAGCATGCAGGAGG - Intergenic
1114032604 14:18589373-18589395 CTTGGTGATCACCTGGGAGCTGG - Intergenic
1114077388 14:19168398-19168420 CTTGGTGATCACCTGGGAGCTGG - Intergenic
1114564608 14:23621067-23621089 CTTGGTGCCTAGCATGAAGTGGG + Intergenic
1114631931 14:24164711-24164733 CTCTGAGAGCAGCATGGAGCAGG + Exonic
1115931784 14:38505261-38505283 ATTAATGACTAGCATGGAGCTGG - Intergenic
1117154262 14:52922297-52922319 CTTGGCTGCCAGCATGGGGCTGG + Intronic
1119679374 14:76580567-76580589 CTGGGTGACAGGCATGGAACTGG + Intergenic
1119919099 14:78429665-78429687 CTTGGTCAGGAGAATGGAGCAGG - Intronic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1121500629 14:94434083-94434105 CTCGGTAACCAGCAGGGGGCAGG + Intergenic
1122921934 14:104883907-104883929 CTTGGAGGCCAGCGGGGAGCAGG + Exonic
1122930152 14:104929435-104929457 AGTGGTGCCCAGCATGGTGCAGG - Intronic
1202896373 14_GL000194v1_random:12976-12998 CTTGGTGATCACCTGGGAGCTGG + Intergenic
1125719290 15:41837525-41837547 TATGAGGACCAGCATGGAGCTGG + Exonic
1126857551 15:52853671-52853693 GTGGATGATCAGCATGGAGCAGG + Intergenic
1127278753 15:57470676-57470698 CTTGGTGACTAGCACCGCGCTGG - Intronic
1128551137 15:68598715-68598737 CTTGGTGCCCAGCAAAGAGATGG - Intronic
1129373201 15:75110698-75110720 CATGGTAATAAGCATGGAGCAGG - Intronic
1131533483 15:93214446-93214468 CTAGGTGCCCAGCATGCAGGAGG - Intergenic
1132592136 16:730705-730727 CTTCCTGACCACCAGGGAGCAGG + Intronic
1132848639 16:2013312-2013334 CTTGGTGACCTCCTGGGAGCAGG + Intronic
1132885866 16:2181681-2181703 CTTGGGGCCCAGCTTGGGGCTGG + Intronic
1132975620 16:2709825-2709847 CTGGGTGCCCAGCATGAGGCCGG + Intergenic
1136024710 16:27462097-27462119 CCTGGTCAGCAGCATGGAGCTGG + Intronic
1136254721 16:29030326-29030348 CTTGGACACCTGCAGGGAGCTGG - Intergenic
1136276537 16:29182299-29182321 GTGTGTGTCCAGCATGGAGCAGG - Intergenic
1136610823 16:31363912-31363934 AGTGGTGAGCAGCAGGGAGCCGG - Intronic
1137255409 16:46771006-46771028 CTTGGTCTACAGCATAGAGCAGG + Intronic
1137445363 16:48528312-48528334 GTGAGTGACCAGCAGGGAGCTGG - Intergenic
1137582751 16:49643935-49643957 CTTGGTGACCAGCATGGAGCAGG + Intronic
1139987037 16:70907197-70907219 CTGGGTGTCCAGCAGGGAGTTGG + Intronic
1140716337 16:77728766-77728788 CCTGGTGCCCAGCAAAGAGCTGG + Intronic
1141166486 16:81664285-81664307 CTCGATGACCACCATGGACCGGG - Exonic
1141513717 16:84529068-84529090 CCTGGTGCCCAGCAAGGAGTAGG - Intronic
1142122847 16:88395692-88395714 CTGTGTGACCAGCAAGGAGAAGG + Intergenic
1142252028 16:88996424-88996446 CTGGGTGAGCAGGATGGGGCTGG - Intergenic
1142369134 16:89668503-89668525 CTGGGAGAGCAGGATGGAGCTGG - Intronic
1146343364 17:32041033-32041055 CCTGGAGACCAACATTGAGCAGG + Intronic
1147934303 17:44002647-44002669 CTTGCTTAACAGCATGGATCTGG + Intronic
1147935497 17:44008331-44008353 CTGGGTGCCCAGCATGCAGTAGG + Intronic
1149604321 17:57914131-57914153 CTCAGTGCCCAGCATAGAGCAGG + Intronic
1150066759 17:62116483-62116505 CTTGTTGACCAGGCTGGAGTTGG - Intergenic
1151321386 17:73354652-73354674 CTGGGTGACCTCCCTGGAGCAGG - Intronic
1151370513 17:73644086-73644108 CATGGTGACCAGCCTGGAGAGGG + Exonic
1151674368 17:75590034-75590056 CTTGGAGACCCGCCTGCAGCAGG + Intergenic
1152299654 17:79487616-79487638 CTGGGTGAGTGGCATGGAGCTGG + Intronic
1152666056 17:81570307-81570329 CTGGGTGCCCAGCACGGGGCTGG + Intronic
1155474479 18:26224582-26224604 CTTGGTGACCAGCACACAGGAGG + Intergenic
1157081067 18:44525721-44525743 CTAAGGGCCCAGCATGGAGCAGG + Intergenic
1157408219 18:47441455-47441477 CTTTGTGCTCAGCATAGAGCAGG + Intergenic
1158017674 18:52803966-52803988 CTTGGGCACCAGCATGGTGGTGG + Intronic
1158319508 18:56247828-56247850 CTAGGTGACCAGCTTGGGACTGG - Intergenic
1159669335 18:71203643-71203665 TTTGGTGATCAGCATGGGGGTGG - Intergenic
1162274150 19:9639760-9639782 CTTGGTGTCCATCATGGTCCAGG + Intronic
1162616930 19:11809408-11809430 CTCAGTGACCATGATGGAGCAGG - Intronic
1162906966 19:13829910-13829932 ATGGCTGGCCAGCATGGAGCTGG + Intronic
1163440547 19:17320531-17320553 CATGGTGCCAAGGATGGAGCGGG + Exonic
1165246883 19:34503040-34503062 CATGGTGACCGGGATGGAGCAGG - Exonic
1168246294 19:55114446-55114468 CTTGGGGACCTGCCTGGAGAAGG + Intronic
1168343032 19:55636598-55636620 AATGTTGACCAGGATGGAGCTGG + Intronic
925922539 2:8647125-8647147 CTTGGGGCCCAGCAAGGATCAGG + Intergenic
927335307 2:21915923-21915945 CATGGTGACCAGGATGGAAGGGG - Intergenic
929892737 2:45932038-45932060 CTGGGTGACCAGCATCCAGATGG + Intronic
930720209 2:54631035-54631057 CAAGCTGACCGGCATGGAGCGGG + Exonic
931664297 2:64599214-64599236 TTTGGTAACTAGCAAGGAGCTGG - Intergenic
935428402 2:102945718-102945740 CTTGGTGAACAGTAAAGAGCAGG + Intergenic
937480154 2:122250014-122250036 CTGGGAGACAAGCATGGAACAGG + Intergenic
937990479 2:127659414-127659436 CGTGGAGACCAGCAGGGAGCTGG - Intronic
938099229 2:128486782-128486804 CTTGGTGGGCACCATGGAGACGG + Intergenic
938491835 2:131765202-131765224 CTTGGTGATCACCTGGGAGCTGG - Intronic
938495731 2:131797140-131797162 CTTGGTGATCACCTGGGAGCTGG + Intronic
938591874 2:132747367-132747389 CTTTGTGACCTGCATAGATCTGG - Intronic
942078005 2:172374641-172374663 CTTTGTGACTACCATGGATCTGG + Intergenic
943092545 2:183391803-183391825 ATTGGTGACCATAATGGTGCAGG - Intergenic
945968018 2:216209158-216209180 CCTGGTTGACAGCATGGAGCAGG + Intergenic
948005406 2:234603994-234604016 CCTGGTGGCCAGCATGGAGGAGG - Intergenic
948931457 2:241134963-241134985 CTTGTTGACAAGCATGGGGTGGG - Intronic
1171448106 20:25218751-25218773 CTGGGTGCCCAGCATGCAGCGGG - Intronic
1172173977 20:32961270-32961292 CCTGGTGCCCAGCAGGGAGCAGG + Intergenic
1172969496 20:38863028-38863050 CTTGGAGACCATCGTGGTGCTGG + Intronic
1173660226 20:44728023-44728045 CTTGTTGCCCAGGCTGGAGCTGG + Intronic
1174703709 20:52634950-52634972 TTTGGTGACCTGCAGGGAGGGGG + Intergenic
1175806347 20:61831288-61831310 CGTGGTGACCAGCAAAGACCTGG + Intronic
1176616060 21:9028972-9028994 CTTGGTGATCACCTGGGAGCTGG + Intergenic
1178523340 21:33304093-33304115 CTTGGTGACCAGCCAGTAGCAGG + Intergenic
1178678774 21:34653974-34653996 CCTAGAGACAAGCATGGAGCAGG + Intergenic
1179245657 21:39632105-39632127 CCTGGTGGCTGGCATGGAGCTGG + Intronic
1180246965 21:46554808-46554830 CTTGCTGACCTGCATGGCGAGGG - Exonic
1180249049 21:46567451-46567473 CCTGGTGACCAACGTGGTGCTGG + Exonic
1180293196 22:10862028-10862050 CTTGGTGATCACCTGGGAGCTGG - Intergenic
1180456717 22:15516430-15516452 CTTGGTGATCACCTGGGAGCTGG - Intergenic
1181713597 22:24707322-24707344 CCTGGTGGCCAGCAGGAAGCTGG + Intergenic
1183365574 22:37404969-37404991 CTTGATCACCAGCAGGTAGCTGG - Intronic
1183946381 22:41328398-41328420 CCCAGTGCCCAGCATGGAGCAGG - Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
949898677 3:8792090-8792112 CTAGGTGCTCAGCATGGTGCCGG + Intronic
949917326 3:8975192-8975214 CCTGGAGTCCAGTATGGAGCCGG + Intergenic
950139996 3:10608868-10608890 CCTGGTGCCTAGCAGGGAGCTGG + Intronic
952756628 3:36874552-36874574 CTTGGTAACAAGCAAGGAGAGGG + Intronic
953090620 3:39722395-39722417 CTAGCTGACCTGCATGGAACAGG + Intergenic
953707874 3:45244870-45244892 TTAGGGGATCAGCATGGAGCTGG + Intergenic
955322731 3:57985873-57985895 GGTGGAGACCAGGATGGAGCAGG + Intergenic
955354315 3:58217750-58217772 CGTGGGAACCAGCAGGGAGCTGG + Intergenic
958821764 3:98982662-98982684 CTTTGTGACCAGTATGTAGAAGG + Intergenic
961339260 3:126206134-126206156 CTGGGTGTCCAGCATAGATCTGG - Intergenic
962073739 3:132058467-132058489 TCTGGCCACCAGCATGGAGCAGG + Intronic
967007535 3:185398672-185398694 CATGGTGCCTAGCATGTAGCAGG + Intronic
967501202 3:190200163-190200185 CTTGTTGCCCAGGCTGGAGCTGG - Intergenic
968869606 4:3235004-3235026 TGTGGTGGCCAGCATGGAGGTGG + Intronic
969443609 4:7232123-7232145 CTTGGGGCACAGCGTGGAGCAGG + Intronic
969709442 4:8834370-8834392 CTGGGTGAACAGCCTGGAGCAGG + Intergenic
976325124 4:83762631-83762653 CTTGGTTAACAGAATGGAGGGGG + Intergenic
980869436 4:138594244-138594266 CTTAGGGACCAGCATGCAGCAGG - Intergenic
983755476 4:171329305-171329327 CTTGCAGGCCAGCATGGAACTGG - Intergenic
986519515 5:8599129-8599151 CCTGGTGTCTGGCATGGAGCTGG - Intergenic
986893163 5:12333506-12333528 CTTAGTGACCTGGATGGAGCTGG - Intergenic
996302837 5:122008351-122008373 CTTGGTTACCAGCCTGGAGTCGG + Intronic
996760108 5:126978301-126978323 GTTGGTGACCCGAATGGGGCTGG - Intronic
998938012 5:147251143-147251165 CTGGCTCATCAGCATGGAGCAGG + Intronic
999271363 5:150298107-150298129 CATGGTGACCTGCATGGATGAGG - Exonic
1000330611 5:160202396-160202418 CATGTTGATCAGTATGGAGCTGG - Intronic
1002201335 5:177530378-177530400 CTTGGTGACCAGCAAGATGGTGG - Intronic
1002278544 5:178118129-178118151 CCCAGTGCCCAGCATGGAGCGGG - Intronic
1002308395 5:178297741-178297763 CTTGCTGCCCAGATTGGAGCTGG + Intronic
1003109107 6:3238698-3238720 CTTGTTGCCCAGGCTGGAGCGGG + Intronic
1004804994 6:19193796-19193818 CTTGGTTAACAGTATGGGGCTGG + Intergenic
1006844323 6:37051845-37051867 CTGTGTGCCCAGCACGGAGCTGG + Intergenic
1006911052 6:37563925-37563947 CTCTGTGACCAGCATGGCCCAGG + Intergenic
1007280845 6:40711154-40711176 TTTGGTGGCCAGCATCCAGCTGG - Intergenic
1007782085 6:44260192-44260214 CCTGGGCACCAGCCTGGAGCAGG + Exonic
1010013675 6:71079553-71079575 CTTGGTGCCTAGCATGGGGCTGG + Intergenic
1010099574 6:72088459-72088481 GTTCGAGACCAGCCTGGAGCCGG - Intronic
1011658853 6:89576843-89576865 CATGGTAACCAGCCTTGAGCTGG - Intronic
1012683119 6:102208735-102208757 CTTGGTCAGCAGCATGGAAAGGG + Intergenic
1013550077 6:111199045-111199067 CTTGATGACCAGCATAGACACGG + Intronic
1015369031 6:132429653-132429675 CTTGGACACCAGTATGGAGGAGG + Intergenic
1015747703 6:136527782-136527804 CTTATTGTCCAGCATGGTGCTGG + Intronic
1017254558 6:152318257-152318279 TTTGGTGACCATCAAGGTGCTGG - Exonic
1018172058 6:161151385-161151407 CGTGATGAACAGCATAGAGCTGG + Intronic
1018617902 6:165705111-165705133 CCTGGGGACCAGCATGGAATGGG + Intronic
1019789848 7:3004114-3004136 CATGGTAACCAGCAGGAAGCTGG - Intronic
1020259290 7:6521642-6521664 CTGTGTCCCCAGCATGGAGCTGG + Intronic
1022244241 7:28542600-28542622 CTTGGTGAGCAGCAGAGAGAGGG - Intronic
1022443666 7:30452918-30452940 CATGGACACCATCATGGAGCTGG - Exonic
1023098875 7:36692193-36692215 CATGGTGCCTGGCATGGAGCAGG + Intronic
1024216012 7:47248618-47248640 CTTGGTGGCCACCTTGGATCTGG - Intergenic
1024858056 7:53804633-53804655 CTGCCTGACCAGCATGGAACAGG - Intergenic
1027219272 7:76203630-76203652 CATTGTGCCCAGCATGGAGCTGG - Intronic
1030675889 7:112384946-112384968 CTTGGTGCCTAGATTGGAGCTGG - Intergenic
1032463819 7:132130952-132130974 CGTAGTGCTCAGCATGGAGCCGG + Intronic
1035076514 7:156181108-156181130 CTTGGTGCAGAGCAAGGAGCTGG - Intergenic
1035358031 7:158290530-158290552 CTTGGGTACCAGCCTGGAGTAGG + Intronic
1035862391 8:3043539-3043561 CATGGTGCCCAGCATAGAGTAGG + Intronic
1037367303 8:18136467-18136489 CTTGTTGACCAGGCTGGAGCTGG - Intergenic
1037600584 8:20390646-20390668 CAGGGTAACCAGCATGGTGCAGG - Intergenic
1037886324 8:22598307-22598329 CCTGGTGACCAGACTGGGGCTGG - Intronic
1038613783 8:29075280-29075302 CAGGGTGACCAGGATGGAGGAGG - Exonic
1038946996 8:32372348-32372370 CTTGTTAAACAGCATGGAGATGG - Intronic
1040024368 8:42768409-42768431 CATGCTGACCAGCAAGGGGCAGG - Exonic
1040433905 8:47371001-47371023 CTTGGTGACCAGCACAGTGGAGG - Intronic
1043005387 8:74811848-74811870 CTTGCTGACAAGCCTGCAGCTGG + Intronic
1047340651 8:123977236-123977258 CACGGTGTCCAGCATAGAGCAGG + Intronic
1047389234 8:124436838-124436860 TGGGGTGACCAGCAGGGAGCAGG - Intergenic
1047524385 8:125619936-125619958 CTTCATGAGCAGGATGGAGCAGG + Intergenic
1048708700 8:137183864-137183886 CATGGTGCCCAGCATGGTGTGGG - Intergenic
1049681803 8:143922158-143922180 GCTGGTGGCCAGCATGGAGGAGG - Exonic
1052339813 9:27354046-27354068 CTTGGTCTCCAGCAGGGAGGGGG - Intronic
1056602433 9:88056579-88056601 GTTTGTGGCCAGCATGGAGGAGG + Intergenic
1056766412 9:89447160-89447182 CTTGCAGGCCAGCATGGAACAGG + Intronic
1058673527 9:107380723-107380745 CTTGGTTACCAGGCTGTAGCTGG - Intergenic
1059647744 9:116284085-116284107 CTTGGTGTCTAGCATGAACCTGG - Intronic
1059874347 9:118617602-118617624 CTTGATTTCCAGCATGGAACAGG + Intergenic
1060155628 9:121318217-121318239 CCTGGTGTCCAGCCTGGGGCTGG - Intronic
1060520852 9:124293109-124293131 CTTGGTGACCACAATGCAGCTGG - Intronic
1060998868 9:127890978-127891000 CTTGGTGCCCAGCAGGTGGCTGG + Exonic
1061205486 9:129160762-129160784 CTTGGGGAACAGCAAGGAGGAGG + Intergenic
1061512557 9:131069906-131069928 CCTGGTGCCCGGCATAGAGCTGG - Intronic
1062041058 9:134404523-134404545 CTGAGTGCCCGGCATGGAGCTGG + Intronic
1062221731 9:135419682-135419704 CTTGATGCCCAGTAGGGAGCCGG - Intergenic
1062553473 9:137101606-137101628 CGAGGTGACCAGCATTCAGCTGG + Exonic
1062631619 9:137465543-137465565 CTTGGGGACTGGCATGCAGCAGG - Intronic
1187314940 X:18184139-18184161 TATGGTGAGCTGCATGGAGCTGG - Intronic
1189261492 X:39682136-39682158 CTTGGTGACCTGCAGGAAGCAGG - Intergenic
1190264990 X:48822936-48822958 CTTGGTGACCAACTTAGAACTGG - Exonic
1191058680 X:56271451-56271473 CTTGGAGACCACTATGGAGAAGG - Intronic
1193773941 X:85620512-85620534 CCTGGTGACTAGCAGGGAGCAGG - Intergenic
1195814421 X:108869457-108869479 CTTGGTTCCCAGGATGGAGCAGG - Intergenic
1197537612 X:127709095-127709117 CTTGCTGAGCTGCCTGGAGCTGG - Intergenic
1198437277 X:136629608-136629630 CTGTGTGCCCAGCATGCAGCTGG + Intergenic
1198466224 X:136907081-136907103 CTTGGTGCCCAGCAGGTGGCTGG + Intergenic
1201149447 Y:11087696-11087718 CTTGGTGATCACCTGGGAGCTGG + Intergenic