ID: 1137582999

View in Genome Browser
Species Human (GRCh38)
Location 16:49645614-49645636
Sequence CTCTGTGACCAACAGGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137582999_1137583004 12 Left 1137582999 16:49645614-49645636 CCAAAATCCTGTTGGTCACAGAG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1137583004 16:49645649-49645671 CTGACAGATACCGTATGATATGG 0: 1
1: 0
2: 0
3: 6
4: 67
1137582999_1137583005 17 Left 1137582999 16:49645614-49645636 CCAAAATCCTGTTGGTCACAGAG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1137583005 16:49645654-49645676 AGATACCGTATGATATGGTTTGG 0: 1
1: 0
2: 18
3: 155
4: 919

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137582999 Original CRISPR CTCTGTGACCAACAGGATTT TGG (reversed) Intronic
901768938 1:11520896-11520918 CTCTCAGACCAACAGTCTTTGGG - Intronic
902254291 1:15177549-15177571 GTCTGTGACCAACTGCATTTGGG - Intronic
902593774 1:17494125-17494147 CTCTGGGACCAAAACAATTTAGG - Intergenic
902992472 1:20198091-20198113 ATCTCTGACCAAAAGGATTATGG - Intergenic
903354461 1:22737747-22737769 GTCTGTTACCAACAGGCTCTTGG + Intronic
907607556 1:55833383-55833405 CTCAGAGTCCAACAGGATTCTGG + Intergenic
907820963 1:57968191-57968213 CTCTGTGACAAACAGGACACAGG - Intronic
910378113 1:86595337-86595359 CTCTGTCACCATCAGCATTTTGG + Intergenic
911209467 1:95124131-95124153 CTTTGTTTCAAACAGGATTTGGG + Intronic
912183464 1:107246790-107246812 CTCTGTTATAAACAGGATCTTGG - Intronic
912721896 1:112027404-112027426 CTCTGTTCCCAAAAGGGTTTTGG - Intergenic
916453693 1:164948282-164948304 CTCTCTGACTTACAGGATTTTGG + Intergenic
917080948 1:171256459-171256481 CTCTGGGCCCAACAGGAGTAAGG - Intronic
920052575 1:203172627-203172649 CTCTGAGACTAACAGATTTTGGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1065362243 10:24899399-24899421 CTCTGAGATCAACTGGATTGGGG + Intronic
1068078965 10:52294393-52294415 CTCTGTGACCAACAGATGTGTGG - Exonic
1068792993 10:61047802-61047824 CTCTGTGACCAATAGTAAGTTGG - Intergenic
1069710347 10:70483798-70483820 CTCTGTGACCAGCAGGAAAGGGG - Intronic
1073573185 10:104598231-104598253 CACTGTTAGTAACAGGATTTGGG - Intergenic
1074253935 10:111781752-111781774 CTCTGAGGCCAACAGGATGTGGG + Intergenic
1076506184 10:130974029-130974051 TTTTGTGTCCAACAGAATTTAGG - Intergenic
1076735844 10:132458602-132458624 CGCTGTGGCCCACAGGAGTTGGG - Intergenic
1077777866 11:5291614-5291636 TTCTGTGACCAACAGACTGTGGG + Intronic
1081921437 11:46781137-46781159 CTCTGGGAGGAACAGGTTTTGGG - Intronic
1083230484 11:61314800-61314822 CCCTGTGACCACCAGTTTTTTGG + Intronic
1084678579 11:70651541-70651563 CTCTGAGGCCAACAGCATTGGGG - Intronic
1084839521 11:71833718-71833740 CCCAGTGACCAACAGTATTGGGG - Intronic
1086037265 11:82431762-82431784 ATCTCAGAACAACAGGATTTAGG + Intergenic
1086991017 11:93303850-93303872 CTCTGTCAGCCACAGGATATGGG - Intergenic
1096796931 12:54083651-54083673 CTCTTAGACCAAGGGGATTTGGG - Intergenic
1098422893 12:70322443-70322465 CTTAGTTACCAACAGGATCTAGG + Intronic
1098652585 12:72991664-72991686 CTGTCTCACCAAAAGGATTTGGG - Intergenic
1099723962 12:86400162-86400184 TTCTGTGACCAAAAGGGTTGGGG - Intronic
1101733641 12:107446572-107446594 CTATGTGACCAAAAGGAGCTCGG + Intronic
1102855993 12:116294251-116294273 CTCTGTGGCCAGCAGGAGCTTGG + Intergenic
1103913170 12:124363058-124363080 CCCTGAGACCCAGAGGATTTGGG - Intronic
1104064368 12:125294728-125294750 TACTGTGACCAGCAGGACTTCGG - Intronic
1104647939 12:130510218-130510240 CTGTGGGACAAATAGGATTTAGG - Intronic
1104672396 12:130689679-130689701 CTCTGTGTCCATCAGCACTTGGG - Intronic
1106175081 13:27323320-27323342 CTCTGTGACCTGGAGGACTTGGG - Intergenic
1109304128 13:60619971-60619993 CTCAGTGAGTAACAGGACTTGGG - Intergenic
1110087734 13:71403635-71403657 TTATGTGACCAATAGGATATAGG - Intergenic
1110851049 13:80245387-80245409 CTCTGTCACCAACAGGATGAAGG + Intergenic
1112472429 13:99701146-99701168 CTCTGTGACCAAAAGTACATAGG + Intronic
1113141489 13:107156606-107156628 CTCCATGACCAACTGGCTTTAGG - Intergenic
1118437547 14:65785242-65785264 CTCTGTGACCCACAAGTTTCTGG - Intergenic
1121755789 14:96401004-96401026 CCCCGTGACCAATAGGATTCAGG - Intronic
1124692806 15:31839429-31839451 GGCTGTGACCAACAGGATGAGGG + Intronic
1125446611 15:39764809-39764831 CTTTGTGACAAACAAGTTTTGGG - Intronic
1127630781 15:60825721-60825743 TTCTGTGACATACAGGAATTGGG + Intronic
1129596953 15:76973018-76973040 CTCTCGAAACAACAGGATTTGGG + Intergenic
1129666714 15:77583277-77583299 CTCTCTGACAATCAGGATTTGGG + Intergenic
1129979768 15:79857730-79857752 CACTGTGCCCAGCCGGATTTTGG - Intronic
1133317074 16:4891610-4891632 CTGTGTGACTTACGGGATTTCGG - Intronic
1133413286 16:5586139-5586161 CTCTGTGGCCAGCAGAAGTTGGG + Intergenic
1137582999 16:49645614-49645636 CTCTGTGACCAACAGGATTTTGG - Intronic
1138271011 16:55695863-55695885 CTCTGTGGCCATAAGGATATGGG - Intronic
1140221448 16:73047565-73047587 CTGTGTGCCCAGCAGAATTTAGG + Intronic
1141087929 16:81110167-81110189 CTCTGTGCCCACCAGGATGAGGG + Intergenic
1141294713 16:82756903-82756925 CTCTGTGAGGGCCAGGATTTGGG + Intronic
1142031403 16:87840281-87840303 CTCTGGGGCCAGCAGGATGTGGG - Intronic
1142667491 17:1471102-1471124 CTCTGTGGCAAACAGGGTCTTGG + Exonic
1143993215 17:10984756-10984778 CTCTGAGACTAGAAGGATTTGGG - Intergenic
1147330848 17:39698575-39698597 CTCTGGGACCAAGAGGACCTGGG - Intronic
1151333796 17:73428166-73428188 CACTGTGCCCAGCTGGATTTTGG - Intronic
1151470269 17:74313710-74313732 CTTTGTGACCACCAGCGTTTTGG - Intronic
1152200193 17:78940993-78941015 CCCTGTGGCCAGCAGGATTGAGG + Intergenic
1155990618 18:32275526-32275548 CCCTGTCATCAACAGGACTTTGG - Intronic
1158577217 18:58648586-58648608 TCATGTCACCAACAGGATTTTGG - Intergenic
1160514029 18:79468852-79468874 CTCTGTGACCCCCAGGATTGTGG + Intronic
1160514068 18:79468962-79468984 CTCTGGGACCCCCAGGATTGTGG + Intronic
1160891500 19:1381005-1381027 CTGTGTGACCAACAGAATGGCGG - Intergenic
1160994148 19:1874043-1874065 CACTGTGATGAAGAGGATTTTGG - Intergenic
1162835144 19:13311891-13311913 TTCTGAGACCAACAGGACTATGG + Intronic
1163068044 19:14813903-14813925 CACCATGACCAACAGGACTTAGG + Intronic
1164023449 19:21329255-21329277 CTCTGTGACCTGCAGGTATTGGG - Exonic
1164624294 19:29715924-29715946 ACCTGTGACCTACAGCATTTTGG + Intergenic
1165185045 19:34011766-34011788 CTTTGTGACAAAAAGGTTTTGGG + Intergenic
1165312517 19:35037425-35037447 CTCAGTGCCCAAATGGATTTAGG - Intronic
1166302451 19:41919635-41919657 GTCTGTGACACACAAGATTTTGG + Intronic
1168188658 19:54721223-54721245 TTATGTGACCATGAGGATTTGGG + Intergenic
931018293 2:58011825-58011847 CTCTGTGAAAAACAGTATCTGGG + Intronic
934132765 2:88965405-88965427 CTCTCTGACCAACTGAAATTAGG - Intergenic
934974201 2:98789018-98789040 CCCTGAGACCATCACGATTTCGG - Intergenic
935413332 2:102788471-102788493 CTCTGTGACCTTGAGGATTCTGG + Intronic
941248883 2:163136385-163136407 CTTTGTCACCAACAGAAATTAGG + Intergenic
942345927 2:175003232-175003254 CACTGTAACAAACTGGATTTTGG + Intronic
942810568 2:179995154-179995176 GTCTGTGGGCATCAGGATTTAGG - Intronic
944037164 2:195308968-195308990 CTCTGTGACCAACAGGGACTGGG + Intergenic
948222980 2:236288138-236288160 CTCTGTGATCATCAGCCTTTCGG - Intergenic
948427721 2:237898389-237898411 CTCTCTGACCAGCCTGATTTAGG + Intronic
1169619029 20:7483847-7483869 CAGTGTGAACAACAGTATTTTGG - Intergenic
1170880241 20:20290604-20290626 CTGTGTAGCCAACAGGATATTGG + Intronic
1174570529 20:51498077-51498099 GTCTGTGGCCAACATGAATTGGG - Intronic
1174739871 20:53002116-53002138 CTCTGTGCCACACAGGCTTTGGG + Intronic
1176126159 20:63475798-63475820 CTCTGTGACCAGCACCATATGGG - Intergenic
1176194077 20:63829130-63829152 CTCTGTGACCACCAGGGGCTGGG + Intronic
1179921948 21:44512281-44512303 CTCTGAGACCCACAGGAGCTAGG + Intronic
1180582664 22:16855730-16855752 CCCTGTGACCAGCAGGTATTGGG + Intergenic
1185189130 22:49422970-49422992 CTCTGTGCCCAGCTGGCTTTGGG - Intronic
952478868 3:33739234-33739256 CTCTGTGACCAACCGGGGCTGGG + Intergenic
955262118 3:57402393-57402415 CCCGGTGACCAACAGGATAGTGG - Intronic
955574304 3:60342669-60342691 CTTTGAGCCCAACAAGATTTTGG + Intronic
955792004 3:62597723-62597745 CTCTGTGTCCAATAGGATGGGGG - Intronic
956592942 3:70934504-70934526 CTATGTGAGGAATAGGATTTGGG - Intergenic
957147116 3:76438953-76438975 GTTTGAGAACAACAGGATTTGGG + Intronic
957219882 3:77368392-77368414 CTTTGTTACTAACAGGCTTTGGG + Intronic
957249330 3:77752866-77752888 CTCAGTCTCCAACATGATTTTGG - Intergenic
958260295 3:91372844-91372866 CTCACTCACCAATAGGATTTGGG - Intergenic
960188541 3:114674324-114674346 CTTTGTGAAGAACAGGCTTTGGG + Intronic
960565044 3:119123847-119123869 CCCTGTAATCAAAAGGATTTGGG - Intronic
962695701 3:137945230-137945252 ATGTGTGACCAACAGGATGGAGG + Intergenic
966142411 3:176771016-176771038 CTTTGAGACCAAGAGCATTTTGG + Intergenic
967225127 3:187283831-187283853 TTTTGTGACCAACATTATTTGGG + Intronic
967229905 3:187327862-187327884 CACTGTGACCAACACAATTAGGG + Intergenic
968905040 4:3447081-3447103 CTCTGTGCCCAGCAGGAGTGAGG + Intronic
972956558 4:44399586-44399608 CTGGGGGACCAACAGGATTTGGG - Intronic
973819871 4:54653388-54653410 CTGTGTGACCAAAAGTATTGTGG - Intergenic
974589287 4:63922120-63922142 CCCTGTGACCAAGAGGAATGAGG + Intergenic
976313870 4:83638613-83638635 CTCTCTGACCAATATGGTTTGGG + Intergenic
976439003 4:85052252-85052274 CTCTGTGACAAGCTGGATGTAGG + Intergenic
976634322 4:87272572-87272594 TTCTGTAACCACCAGGATCTAGG + Intergenic
981045302 4:140259244-140259266 CTCAGTGACCAACTGGACATGGG - Intronic
981361740 4:143853719-143853741 CTCTTTGAACAACATGATTTGGG - Intergenic
981372465 4:143974623-143974645 CTCTTTGACCAACATGATTTGGG - Intergenic
981381554 4:144077827-144077849 TACTCTGACCAACATGATTTGGG - Intergenic
983328116 4:166286276-166286298 TTCTGTAATCAACAGCATTTTGG - Intergenic
984830897 4:183971964-183971986 CAGTGTGACCTACTGGATTTCGG - Intronic
986279358 5:6311015-6311037 CTCTGTGGCCAACAGAAACTGGG + Intergenic
987582059 5:19806790-19806812 CTCTGTGAGCAACTGGTTTCAGG - Intronic
991994563 5:72374524-72374546 CTATGTGACCAATAAGATATTGG + Intergenic
994135375 5:96280555-96280577 CTCTGACACCAACATGACTTTGG + Intergenic
995034536 5:107518354-107518376 CACTGTGATTGACAGGATTTTGG + Intronic
995059750 5:107801197-107801219 CTCTGATACCACAAGGATTTGGG - Intergenic
995269049 5:110200212-110200234 CTCTGTGGCCTACAGGATGGTGG + Intergenic
997659090 5:135576415-135576437 CTCCCTGACCTTCAGGATTTGGG - Intronic
1007590410 6:43017423-43017445 CTCTGGGACCAAGGGGATTGGGG + Intronic
1008994935 6:57647550-57647572 CTCACTCACCAATAGGATTTGGG + Intergenic
1009183470 6:60546311-60546333 CTCACTCACCAATAGGATTTGGG + Intergenic
1012591519 6:100987124-100987146 CTGTGTGTCCTACAGGCTTTGGG + Intergenic
1013776532 6:113684634-113684656 CTATGTGAACAACACCATTTAGG + Intergenic
1015128354 6:129780957-129780979 TTCATTGACCAACAGTATTTAGG + Intergenic
1017573757 6:155778562-155778584 CTCTGTGAGGAAATGGATTTGGG - Intergenic
1018564312 6:165135809-165135831 CTGTGTCACTAACAGCATTTTGG - Intergenic
1020769850 7:12376566-12376588 ATCTTTGACTAACATGATTTTGG + Intronic
1023426064 7:40037559-40037581 CTGTGTGACCAACAGAATATTGG - Intronic
1028728008 7:94111010-94111032 CTGTTTGACCAACAGAATATGGG + Intergenic
1031762467 7:125731235-125731257 CACTGAGACAAACAGAATTTTGG + Intergenic
1032552416 7:132796898-132796920 CTTTGTGACCAAGTGGATATGGG - Intronic
1032822127 7:135533733-135533755 CTTTGGGAAAAACAGGATTTGGG + Intergenic
1036046221 8:5143973-5143995 CTCTGTGTGGAATAGGATTTTGG - Intergenic
1039437213 8:37567797-37567819 CTCTGTCTTCAAAAGGATTTAGG + Intergenic
1041760771 8:61363864-61363886 CTCTGTGACCTACCTGACTTGGG + Intronic
1043504068 8:80885714-80885736 CCTGGTGACCAACAGGATGTGGG + Intergenic
1049649689 8:143759861-143759883 CTCTGTGACCCACAGGGTTACGG - Intergenic
1052272866 9:26644693-26644715 CTCAGTGACTAGCAGGAGTTGGG - Intergenic
1053195745 9:36117081-36117103 CTGTGTCACAAACAGGATCTTGG - Exonic
1053754629 9:41293110-41293132 CACTGTGTCCAACAGCATCTGGG - Intergenic
1054260151 9:62857414-62857436 CACTGTGTCCAACAGCATCTGGG - Intergenic
1054331619 9:63762591-63762613 CACTGTGTCCAACAGCATCTGGG + Intergenic
1054450184 9:65399449-65399471 CTCTTAGACCAAGGGGATTTGGG - Intergenic
1056143880 9:83709928-83709950 CTTTGTGAGCCACAGGATCTCGG + Intergenic
1056474820 9:86943938-86943960 ATCTGTTACCAATAGGTTTTAGG - Intergenic
1202798989 9_KI270719v1_random:155505-155527 CACTGTGTCCAACAGCATCTGGG + Intergenic
1186043713 X:5510342-5510364 CACTGTGACCAACAAGTTTTTGG - Intergenic
1186655371 X:11606069-11606091 CGCTGTGATGAATAGGATTTGGG + Intronic
1188687804 X:33090465-33090487 CTCTGTGTCCAACTACATTTGGG + Intronic
1188687898 X:33092172-33092194 CTCTGTGTCCAACTACATTTGGG - Intronic
1189967089 X:46386110-46386132 CTCTTTCACCAGCAGGATTCTGG + Intergenic
1191937161 X:66438218-66438240 CTCTGTGACCAACATGATGCTGG + Intergenic
1193572600 X:83162165-83162187 CTCACTACCCAACAGGATTTTGG - Intergenic
1194891221 X:99382433-99382455 CACTGTGATTAACAGGATTCAGG - Intergenic
1196521433 X:116677860-116677882 CTATTTGACCAACAAAATTTTGG - Intergenic
1199717835 X:150518812-150518834 CTTGGAGACCAAGAGGATTTGGG - Intergenic
1200397464 X:155999547-155999569 CTCTGTGCCCAACAGCATTGGGG + Intronic