ID: 1137583430

View in Genome Browser
Species Human (GRCh38)
Location 16:49649035-49649057
Sequence CTGTCCTTTTTGGTTTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137583430_1137583434 30 Left 1137583430 16:49649035-49649057 CCAGCTTAAACCAAAAAGGACAG 0: 1
1: 0
2: 3
3: 29
4: 182
Right 1137583434 16:49649088-49649110 ACACCCAAAACTTCACAAGCAGG 0: 1
1: 0
2: 0
3: 17
4: 280
1137583430_1137583433 7 Left 1137583430 16:49649035-49649057 CCAGCTTAAACCAAAAAGGACAG 0: 1
1: 0
2: 3
3: 29
4: 182
Right 1137583433 16:49649065-49649087 ACAGGATGAAAGAAGTCTGTTGG 0: 1
1: 0
2: 2
3: 35
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137583430 Original CRISPR CTGTCCTTTTTGGTTTAAGC TGG (reversed) Intronic
901010700 1:6200097-6200119 CTGTCCTTTTTGCTGTAGCCAGG + Intronic
901574294 1:10188360-10188382 CTGTCCCTTTTCATTTAAGCTGG + Intergenic
901730800 1:11277959-11277981 CTTTCCTTTTTTGTTTGAGATGG + Intronic
902774862 1:18668121-18668143 CTGTCCATTTTGATTTAATGGGG - Intronic
903728287 1:25469329-25469351 CATTCCTTTCTGGTTTAAGTTGG + Intronic
907261367 1:53220864-53220886 CTGTCCTGTTCGCTTAAAGCAGG - Intergenic
908873514 1:68643093-68643115 CTGTGCTTTTTAGTTCAAGGTGG + Intergenic
908987677 1:70044310-70044332 CTTTGCTTTTTGGATTGAGCAGG + Intronic
910172421 1:84392228-84392250 CTGTCTTTTTTGGTCAAAGTTGG - Intergenic
910264009 1:85319551-85319573 TTGTCCTTTTGGGTTAAATCTGG - Exonic
910876218 1:91881237-91881259 CTGTCCTTTGAGTTTTAAGAAGG - Intronic
911062244 1:93758444-93758466 CTCTCCTGTTAGGCTTAAGCTGG - Intronic
911485181 1:98496654-98496676 CTGTCCTTTTTAGTTCAAGCTGG - Intergenic
911650066 1:100377775-100377797 ATGTCCTTTGTGGTATAATCAGG - Intronic
912786191 1:112606037-112606059 CTGTCCCTTTTAGTTCAAACTGG + Intronic
914840418 1:151243749-151243771 CTGTCCTTTTTGATCCAAGATGG + Intronic
915425056 1:155818991-155819013 CTGGCCTTTTTGTTTTGAGATGG - Intronic
919536640 1:198796389-198796411 TTGGACTTTTGGGTTTAAGCTGG - Intergenic
920544642 1:206805872-206805894 AATTCCTTTTTTGTTTAAGCTGG - Intronic
922670932 1:227508305-227508327 CTGCCCTTTCTGGTTAAAGGGGG + Intergenic
923145522 1:231195032-231195054 CTGTCCTTTTTGATGTCAGTAGG + Intronic
923433949 1:233950646-233950668 CTGCCATTTTTGGTTTGAGGTGG - Intronic
923944916 1:238873850-238873872 CTGTGCTTTTTAGTTTAATTAGG + Intergenic
1065920947 10:30392482-30392504 TTGGCTTTGTTGGTTTAAGCTGG + Intergenic
1067086143 10:43239441-43239463 CTGACCTTTTTGTTTTTTGCTGG - Intronic
1067970781 10:50968076-50968098 CAGTCCTTTTTGTTTTATTCAGG - Intergenic
1070014219 10:72509416-72509438 CTTTCCTTTGTGGTTTATGATGG - Intronic
1070377749 10:75850360-75850382 CATTCCTTTTTGGTGTATGCTGG + Intronic
1071094777 10:81960737-81960759 CTGTCCTGTTTTGTTCAAACAGG - Intronic
1071719778 10:88131631-88131653 CTGTGCTTTTTGATTTATGTTGG + Intergenic
1071821985 10:89288526-89288548 CTGACCTTATTGTTTTAGGCTGG + Intronic
1075283605 10:121163106-121163128 CTGGCCTTTCTAGTTTAAGAGGG + Intergenic
1075774024 10:124967901-124967923 CTTTCTTTTTTTTTTTAAGCTGG + Intronic
1075822087 10:125323386-125323408 CTTTCTTTTTTTGTTTAAACAGG + Intergenic
1076543099 10:131226872-131226894 CTGTGTTTTTTGGTTGAAGCAGG - Intronic
1082658806 11:55884902-55884924 CTGTCTTTTTTTTTTTAATCTGG + Intronic
1088819876 11:113447976-113447998 CTGTCTATTGTGGTTAAAGCAGG + Intronic
1089969323 11:122679833-122679855 CTTTTCTTTTTGGTTTGAGATGG + Intronic
1090681159 11:129058650-129058672 CTGCCCTGATTGGTTTAAGTGGG - Intronic
1091678265 12:2507313-2507335 CTCCCCTTTCTGGTTTAAGGAGG + Intronic
1094808003 12:34109362-34109384 CTCTCCTCTTTGGTTCACGCAGG - Intergenic
1095243039 12:39883492-39883514 CCGTCCTGTTTGGTTTAATGAGG - Intronic
1095702173 12:45201598-45201620 ATGTCCTTTTTGGTTGAATCAGG - Intergenic
1096782265 12:53998219-53998241 TTTTCCTTTTTGGTCTAAGGGGG - Intronic
1097788014 12:63782528-63782550 CTGTCTTTTTTAGTCCAAGCTGG + Intronic
1098013136 12:66075787-66075809 TTGTCCATTTTGGTTAAAGTTGG + Intergenic
1098290536 12:68953247-68953269 CTCTCTTTTTTTTTTTAAGCAGG + Intronic
1100033936 12:90227631-90227653 CTCTCCTTTTTCTTTTATGCTGG - Intergenic
1100370314 12:93963355-93963377 CTATCCCTTTTGGTCTAAGCTGG + Intergenic
1100927453 12:99565747-99565769 CTGACCTTTTTAGATGAAGCTGG + Intronic
1101715090 12:107303995-107304017 CTGTCCTGAGTGATTTAAGCAGG + Intergenic
1101908006 12:108842220-108842242 CTGTTCCTTTTGGTTTAACTCGG - Intronic
1102062899 12:109947586-109947608 CTGTCCTTATTGTTTAAAACTGG - Intronic
1104473805 12:129053763-129053785 CTGTCCTTTTATCTTCAAGCTGG - Intergenic
1105627055 13:22122703-22122725 ATGTGCTTTTTGATTTAAGAAGG - Intergenic
1106637884 13:31550399-31550421 CTGTCAATTTTGGTTTTACCTGG + Intergenic
1107907353 13:45073566-45073588 ATATCCTTTTTGTTTTAAGTGGG - Intergenic
1110126020 13:71943026-71943048 TTGTCTTTTTTAGTTCAAGCTGG - Intergenic
1111529676 13:89520511-89520533 CTGTCCCTTTTGGTCCAAGCTGG - Intergenic
1112163294 13:96891113-96891135 CTGTTCTTTTTGGTTTGGGTTGG + Intergenic
1114913401 14:27229887-27229909 TTGCCCATTTTGGTTCAAGCTGG - Intergenic
1117351923 14:54889676-54889698 CTGTCCTTTTTGTTTTTGGTTGG - Intronic
1119574156 14:75703111-75703133 CTTTCCTTTTAGATTTAAGCAGG + Intronic
1120059646 14:79967311-79967333 CAGTCCTTTTTAGTCTAAGCTGG + Intergenic
1120059792 14:79968908-79968930 CAGTCCTTTTTAGTCTAAGCTGG - Intergenic
1121930307 14:97966251-97966273 CTGCCCTTTCTGGTCTCAGCTGG - Intronic
1125430554 15:39589221-39589243 CTCTCCATTGTGGTTGAAGCAGG - Exonic
1128148756 15:65348016-65348038 GTGTCCATTTTGGTTTTAGTGGG - Intronic
1129836361 15:78709756-78709778 TTGGCCTTGTTGGTTTAAGCTGG - Intronic
1131135570 15:89932405-89932427 CTATCCTGTTTGGTACAAGCAGG + Intergenic
1131653755 15:94431577-94431599 CTGCCTTTTTTTGTTAAAGCAGG - Intronic
1131816917 15:96231566-96231588 TTCTCCTTTTTGGTTTTAGTTGG - Intergenic
1136023271 16:27453671-27453693 ATTTCCTTTTTTGCTTAAGCTGG + Intergenic
1136649814 16:31659491-31659513 CTGTCCATTTTGGAGTAGGCAGG - Intergenic
1137583430 16:49649035-49649057 CTGTCCTTTTTGGTTTAAGCTGG - Intronic
1138604110 16:58076743-58076765 CCATCCCTTTTGGTCTAAGCTGG - Intergenic
1140184489 16:72755241-72755263 CTGTGCTTTTCAGTTCAAGCTGG + Intergenic
1141004095 16:80336181-80336203 ACTCCCTTTTTGGTTTAAGCTGG + Intergenic
1145065183 17:19757202-19757224 CTGTACTTTTAGTTTTAAGTGGG - Intergenic
1145841332 17:27997579-27997601 ATCTCCTTTTAGGATTAAGCTGG - Intergenic
1151130302 17:71889813-71889835 CTGTCCTTTTTAGTTCCAACTGG + Intergenic
1151590587 17:75041620-75041642 CTGTCCTTTTTCTTTTGAGACGG - Intronic
1153715621 18:7844809-7844831 CTGTCCATTTTGGTCTGAACTGG + Intronic
1154205106 18:12329517-12329539 CTGTCCACTGTGGTTTCAGCTGG - Exonic
1156094549 18:33513301-33513323 CTGCACTTTTTGGTTTTAGTTGG - Intergenic
1157455189 18:47821117-47821139 CTGTCTTTTTTCATTTAAGATGG + Exonic
1157733405 18:50024482-50024504 ATGTCCTTTTTGGTTAAAAAGGG - Intronic
1157958500 18:52125958-52125980 CTGTCCCTTTTGATCCAAGCTGG + Intergenic
1159568931 18:70090115-70090137 CTGTCCTCTTTAGTTCAAACTGG - Intronic
1160437363 18:78862007-78862029 CTGTCCTCCTTGCTGTAAGCAGG - Intergenic
1162791052 19:13063138-13063160 CTGTCCTTTTTGATTTCCTCAGG + Intronic
1162885354 19:13693069-13693091 CTTTCCTTTTTTTTTTAAGATGG + Intergenic
1164153391 19:22573351-22573373 CTGTCCATTCTGTTTTAAGTTGG - Intergenic
1164220461 19:23188546-23188568 CTGTCCATTCTGTTTTAAGTTGG + Intergenic
1166210888 19:41305947-41305969 CTGTCTTTTTAGGGATAAGCAGG - Intronic
1166431239 19:42729721-42729743 CTGGTCGTTTTGATTTAAGCTGG + Intronic
1166434364 19:42754931-42754953 CTGGTCGTTTTGATTTAAGCTGG + Intronic
925015561 2:521887-521909 CTGTCTTTTATGCTTTAAGTTGG + Intergenic
926464982 2:13176865-13176887 CTGGACTTTTGGGTTAAAGCTGG - Intergenic
930426637 2:51221390-51221412 CTGTCCTTTTTTGTTCAGGGGGG - Intergenic
931318914 2:61157503-61157525 CTTTCCTTTTTGGCTTAAGCTGG - Intronic
932383144 2:71304379-71304401 CTTTCCTGTTTGCTTTCAGCTGG + Intronic
932867185 2:75355977-75355999 CTCTCCTTTTTTGTTTAATCTGG + Intergenic
933398194 2:81758249-81758271 CTGTTCTCCCTGGTTTAAGCTGG - Intergenic
936342521 2:111647608-111647630 CTGTCAGTTTTGGTTTATGTTGG - Intergenic
938469830 2:131548320-131548342 CTGACCTTTTTGGTTTGGGTGGG + Intergenic
939518667 2:143201821-143201843 CTGTACTTTTTTATTGAAGCAGG + Intronic
939685201 2:145190375-145190397 CTGTCCTTTTTAGTCCAAGCTGG - Intergenic
940551699 2:155166628-155166650 CCATCCTTTTTTCTTTAAGCAGG + Intergenic
940838602 2:158553469-158553491 CTGTCCTTTTCAGTTCAAGCTGG - Intronic
941010065 2:160289303-160289325 CTTCCCTTTTTGCTTTTAGCGGG - Intronic
941118920 2:161506047-161506069 CTGTTCTTCTTGGCTTAAACTGG + Intronic
941307672 2:163891698-163891720 TTGGACTTTTGGGTTTAAGCTGG - Intergenic
942435508 2:175969568-175969590 TTCTCCATTTTGGTATAAGCAGG + Intronic
944429699 2:199619866-199619888 CTCTCCTTTTAGGTTTATGTTGG + Intergenic
945443477 2:209908580-209908602 CTCTCCTTTTTGGTTGAAAGAGG - Intronic
945457741 2:210068711-210068733 TTGCCCCTTTTGGTTTAAGCTGG + Intronic
945555843 2:211274834-211274856 TTGTCCTTTCTGGTATAAGAGGG - Intergenic
948512540 2:238478641-238478663 CTATCCTTTTCAGTTTAAGCTGG + Intergenic
1170063636 20:12287109-12287131 TTCTCCTTTTGGGCTTAAGCAGG - Intergenic
1172242982 20:33425654-33425676 CTTTCCTTTTTGTTTTAGACAGG - Intronic
1178580743 21:33836017-33836039 TTTTCCTTTTTGGTTTAAAGTGG - Intronic
1181774323 22:25148552-25148574 CTGTCCTTTCTCGCTGAAGCAGG + Intronic
1184862375 22:47180140-47180162 CTGTCTCTTTTGGTTGCAGCAGG - Intergenic
949205694 3:1436568-1436590 CTGTCTTTTTTTGTTTAATGTGG - Intergenic
953303402 3:41802606-41802628 TTGTCATTTCTGGTTTAAACAGG - Intronic
953409748 3:42684027-42684049 CTGTCCCTTTTGTTTTTAGACGG - Intergenic
955490343 3:59475638-59475660 CAGTCCTGTTTGGGTTAACCAGG - Intergenic
956600623 3:71018036-71018058 CTGTGCTTCCTGGGTTAAGCTGG + Intronic
957502209 3:81071742-81071764 CTGTTCTTTTTGGTATTAACAGG + Intergenic
957814965 3:85285646-85285668 CTGTCCTTTTTGGTTTGTTGTGG - Intronic
958610908 3:96424837-96424859 TTGTCCCTTTTGGTTCAAGTTGG - Intergenic
958774409 3:98464329-98464351 CTCTCCTTTTTGGTTTCTGAAGG - Intergenic
960047039 3:113208989-113209011 CTTTCCTTTTTTTTTTAAGATGG - Intergenic
960902677 3:122567539-122567561 CTGTCCTTTTTATCTTAACCTGG + Intronic
963464730 3:145664984-145665006 CTGTCCTTTTTGTTGTAAGAGGG + Intergenic
963579141 3:147102056-147102078 GTATCCTTTTTGGTTTTAACTGG - Intergenic
964948379 3:162255376-162255398 CTGTCCCTTTCAGTTGAAGCTGG + Intergenic
968133217 3:196204678-196204700 CAGTTGTTTTTTGTTTAAGCCGG - Intronic
968276432 3:197443985-197444007 CTGTCCTCTTTGGTCTGTGCAGG - Intergenic
969348403 4:6583394-6583416 CACTCCTTCTTGGTTTTAGCAGG - Intronic
971003363 4:22347176-22347198 CTGTCCCTTTTGGTTCAAGCTGG + Intronic
974009568 4:56594549-56594571 CTCTCCTTTCTGGTTTAAGTAGG - Intronic
976699133 4:87950287-87950309 CAGCCCTTTCTGGTTTAGGCAGG - Intergenic
978292177 4:107154357-107154379 CTTTCCTTTTTTGTTTAACGTGG - Intronic
978594762 4:110365200-110365222 CTGACCTTCTTGGATTCAGCTGG + Intergenic
978871566 4:113584441-113584463 CAGGCCTTCTTGGTTTATGCAGG + Intronic
979827287 4:125255279-125255301 CTGTTCTTTTTTCTTTCAGCTGG - Intergenic
981867496 4:149441636-149441658 CTGTCACTTTTGGTCCAAGCTGG + Intergenic
986915562 5:12615493-12615515 CTGTCTTTTTTGATCCAAGCTGG - Intergenic
987192908 5:15497734-15497756 CTTTCCATTTTGTTTTAAGCTGG + Intergenic
987967250 5:24892902-24892924 CTGTACTTTTTGGTTAGTGCTGG - Intergenic
987993677 5:25247881-25247903 CTGGCATTTTTGTTTTGAGCGGG - Intergenic
988359249 5:30213514-30213536 CTGTCCTTTTTGTTTTTTGGTGG + Intergenic
991923134 5:71677582-71677604 CTTTCCTTGTTGGTGGAAGCAGG + Intergenic
992943750 5:81789343-81789365 CTCTCATTTCTGGTTTAAACTGG + Intergenic
994012443 5:94921488-94921510 ATGTGCTTTGTGGGTTAAGCAGG - Intronic
997860672 5:137412496-137412518 CTGTCCACTTTGGTTTAGGGAGG + Intronic
998822873 5:146072663-146072685 CTGTTCTTTTTTTTTTAAGATGG - Intronic
999030980 5:148290602-148290624 TTTTACTTTTTGGTTTAATCTGG + Intergenic
1001404085 5:171463315-171463337 ATGTCCTTATTGGTTTAAGTCGG - Intergenic
1003621241 6:7702655-7702677 CTCCCCTCTTTGGTTGAAGCAGG + Intergenic
1004498495 6:16187272-16187294 CTGTTCATTTTGGTTTGGGCTGG + Intergenic
1009198393 6:60714623-60714645 TTGTCCTTTTTGAATTAAGTGGG + Intergenic
1010368884 6:75084753-75084775 CCCTCCTTTTTGGTTTTAGGAGG + Exonic
1011240881 6:85270168-85270190 CAGTTCTTCTTGGTTTAAGTAGG + Intergenic
1012275087 6:97263621-97263643 CTGTGCTTTTTGTTTTAAAATGG - Intronic
1012407549 6:98916874-98916896 CTGTAATTTTTGGTCTAGGCAGG - Intronic
1013430441 6:110050548-110050570 CTGTTCTTTTTGGCTTAATCTGG - Intergenic
1014658611 6:124138018-124138040 CTTTGCTTTTTAGTTTAAGTAGG - Intronic
1014886167 6:126784258-126784280 ATGTCCTATTGTGTTTAAGCAGG - Intergenic
1016717365 6:147250057-147250079 CTGTCCTTTTCAGTCCAAGCTGG - Intronic
1019463540 7:1174026-1174048 CATTCCTGTTAGGTTTAAGCAGG + Intergenic
1022709319 7:32836180-32836202 TTGACCTTATTGTTTTAAGCTGG + Intergenic
1023288380 7:38643360-38643382 CTGTCCTTTTTTTTTTAAGACGG + Intergenic
1024188979 7:46985989-46986011 CTGTCCCTTGTAGTTTAAGCTGG + Intergenic
1028210663 7:88070078-88070100 CTGTCCATTTTGGTCCAAGCTGG + Intronic
1028329590 7:89572763-89572785 CTGTCCTTTTTAGTTCAGGAAGG + Intergenic
1028600690 7:92597386-92597408 CTGAAGTTTTTGGCTTAAGCAGG - Intergenic
1029617575 7:101668777-101668799 CTGTCCATTTTGATATCAGCTGG - Intergenic
1030412401 7:109197981-109198003 CTGTCCTCTTTTGTCCAAGCTGG - Intergenic
1031287763 7:119893054-119893076 CTGTCTTTTTTTTTTTAAGTTGG - Intergenic
1035953081 8:4045296-4045318 CTGTCCTTATAGGGTTAGGCAGG + Intronic
1040090904 8:43397635-43397657 CTGGCATTTTTGCTTTAAGAAGG + Intergenic
1041797331 8:61759460-61759482 CTGCCCATTTTGTTTTAAGCTGG + Intergenic
1042841432 8:73127765-73127787 CTGTCCTTTTCGGTCCAAGCTGG + Intergenic
1043114602 8:76234542-76234564 CTGTCTCTTTTTGTCTAAGCTGG - Intergenic
1043832179 8:85002487-85002509 CTGTCCCTTTCAGTCTAAGCTGG + Intergenic
1044418061 8:91958570-91958592 CTGTCCTTTTTTTTTAAAGTAGG + Intronic
1046775305 8:118158294-118158316 CTGTTCTTGCTGGTGTAAGCAGG - Intergenic
1048230745 8:132638498-132638520 CTGTCCTCTTGAGTTTTAGCAGG + Intronic
1049500645 8:142962434-142962456 CTGTCCTGTATGGTTTTATCTGG + Intergenic
1050244828 9:3677807-3677829 CTGTGCTTTTGTTTTTAAGCCGG - Intergenic
1050528378 9:6565366-6565388 CTCTCCTTTCTGGTTTAAGTAGG + Exonic
1052711918 9:32067593-32067615 CTGTCCTTTGCTGTTCAAGCTGG - Intergenic
1053728636 9:41029556-41029578 CTTTCCTTTTTGTTTGAACCAGG - Intergenic
1054699871 9:68402524-68402546 CTTTCCTTTTTGTTTGAACCAGG + Intronic
1056804194 9:89715338-89715360 CTGTCCCTTTTAGTTCAAGCTGG + Intergenic
1057378876 9:94551000-94551022 CTGACCTTTTTGGTTTGAGTGGG - Intergenic
1059446009 9:114338344-114338366 CTGTCCTTTTTGATGTTAGAGGG - Intronic
1060908524 9:127329863-127329885 GGGTCCTTTCTGGTTTTAGCAGG + Intronic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1062395014 9:136349345-136349367 CTGTCATTGCTGGTATAAGCCGG + Intronic
1185721298 X:2383941-2383963 CTGCCCATATGGGTTTAAGCAGG + Intronic
1185915913 X:4034905-4034927 CTCTCCTTTTGGGCTTTAGCTGG - Intergenic
1186131387 X:6469721-6469743 CTGACCTTTTTGATTAAAGTTGG + Intergenic
1186902869 X:14076687-14076709 CTGTATTTTTTGGAATAAGCAGG + Intergenic
1188523113 X:31060321-31060343 CTGTCCTTTTTCTTTTAAACTGG - Intergenic
1189620192 X:42828484-42828506 CTGTTTTTTTTGGTTTTAGGGGG + Intergenic
1189789321 X:44588409-44588431 CTGTCCCTTTTGGTTCAAGTCGG - Intergenic
1189905295 X:45753170-45753192 CTCTCCTTATTGGTTGATGCTGG + Intergenic
1196942886 X:120795024-120795046 TTGTCCTATTTGGTTTCTGCAGG + Intergenic
1197974588 X:132153218-132153240 CTGTCCTTTTCAGTACAAGCTGG - Intergenic
1198803314 X:140469481-140469503 CTTTCCTTTTTTTTTTGAGCCGG - Intergenic
1200354485 X:155534112-155534134 CTGTTCTTTTTGGTCCCAGCTGG - Intronic