ID: 1137585136

View in Genome Browser
Species Human (GRCh38)
Location 16:49659791-49659813
Sequence CCGTCAGCCTGAGCTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137585136_1137585143 -8 Left 1137585136 16:49659791-49659813 CCCAGCCCAGCTCAGGCTGACGG 0: 1
1: 0
2: 0
3: 25
4: 221
Right 1137585143 16:49659806-49659828 GCTGACGGCACCCCTGTGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 137
1137585136_1137585144 -2 Left 1137585136 16:49659791-49659813 CCCAGCCCAGCTCAGGCTGACGG 0: 1
1: 0
2: 0
3: 25
4: 221
Right 1137585144 16:49659812-49659834 GGCACCCCTGTGGGTGGTGCTGG 0: 1
1: 0
2: 1
3: 28
4: 284
1137585136_1137585151 28 Left 1137585136 16:49659791-49659813 CCCAGCCCAGCTCAGGCTGACGG 0: 1
1: 0
2: 0
3: 25
4: 221
Right 1137585151 16:49659842-49659864 GTCTGCCACAGGCAGCTCCACGG 0: 1
1: 0
2: 2
3: 28
4: 261
1137585136_1137585145 -1 Left 1137585136 16:49659791-49659813 CCCAGCCCAGCTCAGGCTGACGG 0: 1
1: 0
2: 0
3: 25
4: 221
Right 1137585145 16:49659813-49659835 GCACCCCTGTGGGTGGTGCTGGG 0: 1
1: 0
2: 0
3: 23
4: 224
1137585136_1137585149 17 Left 1137585136 16:49659791-49659813 CCCAGCCCAGCTCAGGCTGACGG 0: 1
1: 0
2: 0
3: 25
4: 221
Right 1137585149 16:49659831-49659853 CTGGGCCTACAGTCTGCCACAGG 0: 1
1: 0
2: 1
3: 19
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137585136 Original CRISPR CCGTCAGCCTGAGCTGGGCT GGG (reversed) Intronic